prEN 17881

Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment

This document describes a procedure for the identification of single bivalves to the level of genus or species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene [1], [2] followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases [5]. The methodology allows the identification of a large number of commercially important bivalve species.
This method has been successfully validated on raw mussels, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species.

Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand eines definierten mitochondrialen 16S rRNA‑Genabschnittes

Dieses Dokument beschreibt ein Verfahren für die Identifizierung von einzelnen Muscheln auf Gattungs- oder Speziesebene.
Die Identifizierung der Muschelspezies erfolgt durch PCR-Amplifikation eines Segments des mitochondrialen 16S rRNA-Gens [1] [2], gefolgt von der Sequenzierung der PCR-Produkte und einem anschließenden Daten¬bankabgleich der Sequenzen [5]. Diese Vorgehensweise ermöglicht die Identifizierung einer großen Anzahl kommerziell bedeutender Muschelspezies.
Dieses Verfahren wurde erfolgreich an rohen Muscheln validiert, Laborerfahrungen zeigen jedoch, dass dieses Verfahren auch an verarbeiteten Proben, wie z. B. kalt- und heißgeräucherten, gesalzenen, tiefgefrorenen, gekochten, gebratenen und frittierten Proben, angewendet werden kann.
Für die Untersuchung stark verarbeiteter Lebensmittel, wie z. B. Muschelkonserven mit stark degradierter DNA, bei denen die Fragmentlängen nicht für eine Amplifikation der Zielsequenzen ausreichen, ist dieses Dokument in der Regel nicht geeignet. Außerdem ist es nicht anwendbar auf zusammengesetzte Meeresfrüchteprodukte, die mehr als eine Muschelspezies enthalten.

Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial

Le présent document décrit un mode opératoire d’identification des bivalves au niveau du genre ou de l’espèce.
L’identification de l’espèce de bivalve est effectuée par amplification PCR d’un segment du gène de l’ARNr 16S mitochondrial [1], [2], suivie du séquençage des produits de PCR puis de la comparaison des séquences avec les entrées présentes dans les bases de données [5]. La méthode permet d'identifier un grand nombre d’espèces de bivalves importantes sur le plan commercial.
Cette méthode a été validée avec succès sur les moules crues. Toutefois, les expériences en laboratoire montrent qu’elle peut également être appliquée aux échantillons transformés, par exemple fumés à froid, fumés à chaud, salés, congelés, cuits, frits, frits dans l’huile.
D’une façon générale, le présent document ne convient pas à l’analyse d’aliments hautement transformés, par exemple les moules en conserve, contenant de l’ADN fortement dégradé dans lequel les longueurs de fragment ne sont pas suffisantes pour amplifier les cibles. Par ailleurs, il n’est pas applicable aux produits complexes à base de fruits de mer contenant des mélanges d’au moins deux espèces de bivalves.

Pristnost živil - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz školjk, z uporabo definiranega mitohondrijskega genskega segmenta 16S rRNA

General Information

• Status: Not Published
• Publication Date: 10-Apr-2024
• ICS: 07.080 - Biology. Botany. Zoology
• ICS: 67.020 - Processes in the food industry
• ICS: 67.120.30 - Fish and fishery products
• Technical Committee: CEN/TC 460 - Food Authenticity
• Drafting Committee: CEN/TC 460/WG 2 - Species analyses using DNA-based methods
• Current Stage: 4060 - Closure of enquiry - Enquiry
• Start Date: 20-Oct-2022
• Due Date: 17-Aug-2022
• Completion Date: 20-Oct-2022
• Directive: 2017/625 - Regulation (EU) 2017/625 of the European Parliament and of the Council of 15 March 2017 on official controls and other official activities performed to ensure the application of food and feed law, rules on animal health and welfare, plant health and plant protection products
• Directive: 882/2004 - Regulation (EC) No 882/2004 of the European Parliament and of the Council of 29 April 2004 onofficial controls performed to ensure the verification of compliance with feed and food law, animal health and animal welfare rules
• Ref Project: oSIST prEN 17881:2022 - Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment

Standards Content (Sample)

SLOVENSKI STANDARD
oSIST prEN 17881:2022
01-oktober-2022
Avtentičnost hrane - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz
školjk, z uporabo segmentov genov, ki nosijo zapis za mitohondrijski 16S rRNA

Food authenticity - DNA barcoding of bivalves and products derived from bivalves using

a defined mitochondrial 16S rRNA gene segment

Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand

eines definierten mitochondrialen 16S rRNA‑Genabschnittes

Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de

bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Ta slovenski standard je istoveten z: prEN 17881
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.30 Ribe in ribji proizvodi Fish and fishery products
oSIST prEN 17881:2022 en,fr,de

2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

---------------------- Page: 1 ----------------------
oSIST prEN 17881:2022
---------------------- Page: 2 ----------------------
oSIST prEN 17881:2022
DRAFT
EUROPEAN STANDARD
prEN 17881
NORME EUROPÉENNE
EUROPÄISCHE NORM
July 2022
ICS 07.080; 67.020; 67.120.30
English Version
Food authenticity - DNA barcoding of bivalves and
products derived from bivalves using a defined
mitochondrial 16S rRNA gene segment

Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von

de bivalves et produits dérivés de bivalves à l'aide d'un Muscheln und Muschelprodukten anhand eines

segment défini du gène de l'ARNr 16S mitochondrial definierten mitochondrialen 16S rRNA-Genabschnittes

This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee

CEN/TC 460.

If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations

which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.

This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other

language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC

Management Centre has the same status as the official versions.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,

Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,

Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and

United Kingdom.

Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are

aware and to provide supporting documentation.

Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without

notice and shall not be referred to as a European Standard.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels

© 2022 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 17881:2022 E

worldwide for CEN national Members.
---------------------- Page: 3 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
Contents Page

European foreword ....................................................................................................................................................... 3

Introduction .................................................................................................................................................................... 4

1 Scope .................................................................................................................................................................... 5

2 Normative references .................................................................................................................................... 5

3 Terms and definitions ................................................................................................................................... 5

4 Principle ............................................................................................................................................................. 7

5 Reagents and materials ................................................................................................................................. 7

5.1 General ................................................................................................................................................................ 7

5.2 PCR reagents ..................................................................................................................................................... 7

6 Apparatus ........................................................................................................................................................... 8

7 Procedure........................................................................................................................................................... 8

7.1 Sample preparation ........................................................................................................................................ 8

7.2 DNA extraction ................................................................................................................................................. 8

7.3 PCR ........................................................................................................................................................................ 8

7.3.1 General ................................................................................................................................................................ 8

7.3.2 PCR setup ........................................................................................................................................................... 8

7.3.3 Temperature-time program ........................................................................................................................ 9

7.3.4 PCR controls ...................................................................................................................................................... 9

8 Evaluation ....................................................................................................................................................... 10

8.1 Evaluation of PCR products ...................................................................................................................... 10

8.2 Evaluation of the PCR results ................................................................................................................... 10

8.3 Sequencing of PCR products ..................................................................................................................... 10

8.4 Evaluation of sequence data ..................................................................................................................... 11

8.5 Comparison of the sequence with public databases........................................................................ 11

8.5.1 General ............................................................................................................................................................. 11

8.5.2 Sequence comparison of 16S rRNA gene sequences with GenBank .......................................... 11

9 Interpretation of database query results ............................................................................................ 12

10 Validation status and performance criteria ....................................................................................... 12

10.1 Collaborative study for the identification of bivalve species based on 16S rRNA gene

sequence analysis ........................................................................................................................................ 12

11 Test report ...................................................................................................................................................... 14

Annex A (informative) Practical laboratory experiences with the amplificability of 16S

rRNA gene segments from tested bivalve species ............................................................................ 15

Bibliography ................................................................................................................................................................. 16

---------------------- Page: 4 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
European foreword

This document (prEN 17881:2022) has been prepared by Technical Committee CEN/TC 460 “Food

authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to the CEN Enquiry.
---------------------- Page: 5 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
Introduction

Food safety is a key aspect in terms of consumer protection. In the last three decades, globalization has

taken place in the trade of food. Seafood trade channels are becoming steadily longer and more

complicated so that sophisticated traceability tools are needed to ensure food safety. Correct food

labelling is a prerequisite to ensure safe seafood products and fair trade as well as to minimize illegal,

unreported and unregulated (IUU) fishing. Seafood products are increasingly being processed in export

countries. Especially bivalves are often sold without the shells. That makes the identification of species

by morphological characteristics impossible.

The development of harmonized and standardized protocols for the authentication of bivalve products is

necessary to establish reliable methods for the detection of potential food fraud.

---------------------- Page: 6 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
1 Scope

This document describes a procedure for the identification of single bivalves to the level of genus or

species.

The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial

16S rRNA gene [1], [2] followed by sequencing of the PCR products and subsequent sequence comparison

with entries in databases [5]. The methodology allows the identification of a large number of

commercially important bivalve species.

This method has been successfully validated on raw mussels, however, laboratory experience is available

that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-

fried samples.

This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with

highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets.

Furthermore, it is not applicable for complex seafood products containing mixtures of two or more

bivalve species.
2 Normative references

The following documents are referred to in the text in such a way that some or all of their content

constitutes requirements of this document. For dated references, only the edition cited applies. For

undated references, the latest edition of the referenced document (including any amendments) applies.

ISO 16577, Molecular biomarker analysis — Terms and definitions

ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of

animal species in foods and food products (nucleic acid-based methods) — General requirements and

definitions
3 Terms and definitions

For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.

ISO and IEC maintain terminological databases for use in standardization at the following addresses:

— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment

process or result of matching up the nucleotide residues of two or more biological sequences to achieve

maximal levels of identity
[SOURCE: BLAST Glossary]
3.2
BLAST
Basic Local Alignment Search Tool [3]

sequence comparison algorithm optimized for speed used to search sequence databases for optimal local

alignments to a query

Note 1 to entry: It directly approximates alignments that optimize a measure of local similarity, the maximum

signal pair (MSP) score or high scoring signal pair (HSP) score.
---------------------- Page: 7 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
3.3
FASTA format

text-based format for representing either nucleotide sequences or amino acid sequences, which begins

with a single-line description, followed by lines of sequence data

Note 1 to entry: The description line (defline) is distinguished from the sequence data by a greater-than (“>”)

symbol at the beginning.
EXAMPLE An example sequence in FASTA format is shown below:
> Sample_04_16SrRNA gene

ATCACGTAGGATTTTAATGGGCGAACATACCAACCATTGAGACCGCCTACAGCCTCAGGATATCCGGAGCCAACATCGAGG

TCGCAAACTTTCTCATCTATAAGAACTATCAAAGAAAATAACGCTGTTATCCCCGGAGTAACTTCTTCTGTTAATCACTAA

ATAAAGTAAGTGGGTCGTCTATCAAACAAAGAAAAGAAAGAGTCTGATCTTGCTCTTTTGCTGCCCCAGCCAACAACAAAA

GTGGTAAGAATATCTCTGCCACTTAGTTAACAACTTCACGGGGTCTTCTCGTCTATCACTTATATTTAAGCATTTGCACTT

AAAATTCAATTTCATATAATTCAGCTAGAGACAGTTATAGGCTCGTCAATCCATTCACAGGGCCCCCAATTAGAGGGCCAT

AATTTAGCTACCTTAGCACGCTTTACCGCATCCGTTTAAGTCATCTCACTGGGAAGGAACGACCTACTATAAATACAGTAG

GCCATGTTTTT
[SOURCE: BLAST topics, modified]
3.4
GenBank
comprehensive public database of e.g. genetic sequences [5]

Note 1 to entry: GenBank is part of the International Nucleotide Sequence Database Collaboration, which

comprises the DNA DataBank of Japan (DDBJ), the European Nucleotide Archive (ENA), and GenBank at National

Center for Biotechnology Information (NCBI). These three organizations exchange data on a daily basis.

3.5
identity

extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions

in an alignment, often expressed as a percentage
[Source: BLAST Glossary]
3.6
introgressed DNA

DNA sequence (allele) from one taxonomic entity (species) incorporated in the gene pool of another,

divergent entity (species) [6]

Note 1 to entry: Introgression has usually happened via hybridization and backcrossing of individuals belonging

to different species.
3.7
NCBI
National Center for Biotechnology Information

institution which houses molecular biology databases (e.g. GenBank) and provides the BLAST suite

3.8
nucleotide collection
nr/nt

non-redundant database consisting of GenBank sequences, in which identical sequences have been

merged into one entry
---------------------- Page: 8 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
3.9
query

sequence (or other type of search term) to which all of the entries in a data base are to be compared

[SOURCE: BLAST Glossary]
3.10
query coverage
percentage of query covered by alignment to the data base sequence
[SOURCE: BLAST help]
4 Principle

DNA is extracted from bivalves and bivalves products applying a suitable method. A segment of

approximately 550 base pairs (bp) of the 16S rRNA gene is amplified by PCR. In the further course, the

nucleotide sequence of the PCR product is determined by a suitable DNA sequencing method (e.g. Sanger

sequencing). The sequence is evaluated by comparison to sequence entries in databases, thus allowing

the assignment to a bivalve species or genus according to the degree of identity with stored sequences.

5 Reagents and materials
5.1 General

During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade

and distilled or demineralized water or water of equivalent purity, according to ISO 20813. Regarding

laboratory organization, see ISO 20813.
5.2 PCR reagents
5.2.1 Thermostable DNA polymerase (for hot start PCR)
5.2.2 PCR reaction buffer (including MgCl or with separate MgCl solution)
2 2
5.2.3 Deoxynucleoside triphosphate mix (dATP, dCTP, dGTP and dTTP)
5.2.4 Oligonucleotides (see Table 1)

Table 1 — Oligonucleotides for amplification of the 16S rRNA gene region [1], [2]

Name DNA Sequence of oligonucleotide
16SAR 5'-CGC CTG TTT ATC AAA AAC AT-3'
16SBR 5'-CCG GTC TGA ACT CAG ATC ACG T-3'
5.2.5 Agarose

5.2.6 Suitable DNA length standard for assessing the amplification product length

During the collaborative study the laboratories used DNA polymerases and mastermixes of different

commercial providers. Amplificates were produced successfully with all used mastermixes and DNA polymerases.

Deoxynucleotide triphosphates can also be part of a commercial PCR master mix.
---------------------- Page: 9 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
6 Apparatus
Apart from the usual laboratory equipment, the following equipment is required:
6.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA
6.2 Thermocycler
6.3 Gel electrophoresis device
6.4 Gel documentation system
6.5 DNA sequencer
7 Procedure
7.1 Sample preparation

It shall be ensured that the test portion used for DNA extraction is representative for the laboratory

sample. In composed samples (e.g. seafood mixtures), single pure bivalve pieces have to be separated and

analysed. With the analysis of samples composed of several pieces (e.g. bags with different scallops), test

portions for every putative bivalve species are taken and analysed separately. To minimize the risk of

amplifying adhering contaminants, test sample material shall not be taken from the surface of the

laboratory sample. For further information regarding sample preparation, see ISO 20813.

7.2 DNA extraction

Concerning the extraction of DNA from the test sample, the general instructions and measures described

in EN ISO 21571 should be followed, see ISO 20813. It is recommended to choose one of the DNA

extraction methods described in EN ISO 21571:2005 , Annex A. Alternatively, commercial kits can be

used for the extraction and purification of DNA.
7.3 PCR
7.3.1 General

The primers used for the amplification of the section from the mitochondrial 16S rRNA gene are universal

primers. The primer pair 16SAR / 16SBR has been tested against a broad taxonomic range of bivalve

species, and has only failed in a small minority of cases (< 5 % of species tested) [1].

7.3.2 PCR setup

The method was validated for a total volume of 25 µl per PCR. The reagents given in Table 2 should be

used for the 16S rRNA PCR.

Reagents are completely thawed at room temperature and should be centrifuged briefly before usage. A

PCR reagent mixture is prepared containing all PCR components in the given concentrations except for

the DNA extract. The amount of PCR mixture depends on the total volume per PCR and the total number

of the reactions including a su
...