ISO 24480:2024
(Main)Biotechnology — Validation of database used for nucleotide sequence evaluation
General Information
- Abstract
This document describes a practical procedure for nucleotide sequence database evaluation and validation. This document describes minimum requirements for the validation of a nucleotide sequence database. This document is applicable only for databases consisting of entries of nucleotide sequences. This document is not applicable to the general evaluation of the entire database quality including the quality of each data entry. EXAMPLE The use of the validated database is for confirming a representative sequence specificity including primers or probes for qualification and quantification of target nucleic acids by conventional polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), digital polymerase chain reaction (dPCR) and microarray technologies.
- Status
- Published
- Publication Date
- 24-Nov-2024
- Technical Committee
- ISO/TC 276 - Biotechnology
- Drafting Committee
- ISO/TC 276/WG 5 - Data processing and integration
- Current Stage
- 6060 - International Standard published
- Start Date
- 25-Nov-2024
- Due Date
- 13-Jun-2025
- Completion Date
- 25-Nov-2024
Overview
ISO 24480:2024 - Biotechnology - Validation of database used for nucleotide sequence evaluation provides a practical, minimum-requirements procedure for validating nucleotide sequence databases intended for sequence-evaluation tasks. The standard applies only to databases that consist of nucleotide sequence entries (not to full database quality assessments of every individual entry). Its focus is ensuring databases are fit-for-purpose when used to evaluate sequence specificity for oligonucleotides (primers/probes) and other nucleotide-based assays.
Key Topics
- Scope and applicability: validation procedure for databases of nucleotide sequences; not a general per-entry quality audit.
- Two validation roles
- Inclusivity database - must cover intended target sequences and contain reliably annotated, representative entries for sensitivity/inclusivity analysis.
- Exclusivity database - should contain a broad range of related and unrelated sequences to detect potential non-specific hybridization.
- Quality criteria and data indicators: provenance and update history, entry length, number of unidentified nucleotides (Ns), and other metadata used to assess database fitness.
- Validation process and reporting: requirements for documenting validation activities and producing a validation report suitable for inclusion in diagnostic/surveillance method validation.
- Practical tools and examples: guidance refers to in‑silico similarity searches (e.g., BLAST), handling NGS/NGS-derived data sets, and includes informative annexes with example data formats and validation workflows.
- Terminology: defines key terms (inclusivity, exclusivity, sequence similarity, representative/undesirable sequences) to support consistent implementation.
Applications
ISO 24480:2024 is intended for organizations and professionals who perform or rely on nucleotide sequence evaluation:
- Assay developers designing primers/probes for PCR, qPCR, dPCR, and microarray assays.
- Clinical, veterinary and environmental diagnostic laboratories validating molecular tests and surveillance pipelines.
- Biotech and pharmaceutical companies using sequence databases for target confirmation or assay specificity checks.
- Reference laboratories and regulators assessing the adequacy of database-driven in‑silico evaluations as part of method validation. Validated databases per ISO 24480 can be integrated into validated diagnostic or surveillance methods to improve confidence in sequence specificity, selectivity and overall assay performance.
Related Standards
- ISO 20691 - Requirements for data formatting and description in the life sciences (normative reference).
- Referenced terminology and related guidance: ISO/TS 23494‑1, ISO 16577, ISO 20813 (see ISO 24480:2024 bibliography and normative references for details).
Keywords: ISO 24480:2024, nucleotide sequence database validation, inclusivity, exclusivity, primer specificity, qPCR, dPCR, PCR, microarray, BLAST, database provenance, NGS.
Frequently Asked Questions
ISO 24480:2024 is a standard published by the International Organization for Standardization (ISO). Its full title is "Biotechnology — Validation of database used for nucleotide sequence evaluation". This standard covers: This document describes a practical procedure for nucleotide sequence database evaluation and validation. This document describes minimum requirements for the validation of a nucleotide sequence database. This document is applicable only for databases consisting of entries of nucleotide sequences. This document is not applicable to the general evaluation of the entire database quality including the quality of each data entry. EXAMPLE The use of the validated database is for confirming a representative sequence specificity including primers or probes for qualification and quantification of target nucleic acids by conventional polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), digital polymerase chain reaction (dPCR) and microarray technologies.
This document describes a practical procedure for nucleotide sequence database evaluation and validation. This document describes minimum requirements for the validation of a nucleotide sequence database. This document is applicable only for databases consisting of entries of nucleotide sequences. This document is not applicable to the general evaluation of the entire database quality including the quality of each data entry. EXAMPLE The use of the validated database is for confirming a representative sequence specificity including primers or probes for qualification and quantification of target nucleic acids by conventional polymerase chain reaction (PCR), quantitative polymerase chain reaction (qPCR), digital polymerase chain reaction (dPCR) and microarray technologies.
ISO 24480:2024 is classified under the following ICS (International Classification for Standards) categories: 07.080 - Biology. Botany. Zoology. The ICS classification helps identify the subject area and facilitates finding related standards.
ISO 24480:2024 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.
Standards Content (Sample)
International
Standard
ISO 24480
First edition
Biotechnology — Validation of
2024-11
database used for nucleotide
sequence evaluation
Biotechnologie — Validation de la base de données utilisée pour
l'évaluation de la séquence nucléotidique
Reference number
© ISO 2024
All rights reserved. Unless otherwise specified, or required in the context of its implementation, no part of this publication may
be reproduced or utilized otherwise in any form or by any means, electronic or mechanical, including photocopying, or posting on
the internet or an intranet, without prior written permission. Permission can be requested from either ISO at the address below
or ISO’s member body in the country of the requester.
ISO copyright office
CP 401 • Ch. de Blandonnet 8
CH-1214 Vernier, Geneva
Phone: +41 22 749 01 11
Email: copyright@iso.org
Website: www.iso.org
Published in Switzerland
ii
Contents Page
Foreword .iv
Introduction .v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 General . 3
5 Common requirements of the database . 4
6 Inclusivity database: database for inclusivity evaluation . 4
6.1 Quality criteria .4
6.2 Requirements of an inclusivity database .4
6.3 Individual data quality indicators . .5
6.3.1 Data provenance and updates .5
6.3.2 Length of the entries .5
6.3.3 Number of unidentified nucleotides (N) .5
6.4 Validation of the inclusivity database . .5
7 Exclusivity database: Database for the exclusivity evaluation . 6
7.1 Quality criteria .6
7.2 Requirements of the exclusivity database .6
7.3 Validation of the exclusivity database .6
8 Validation report . 7
Annex A (informative) Example of a data entry format . 9
Annex B (informative) Example for the validation of an inclusivity database (Inclusivity) .10
Annex C (informative) Example on validation of an exclusivity database (Exclusivity) .13
Annex D (informative) Example of use of an inclusivity database and an exclusivity database . 17
Annex E (informative) Example on dataset verification command for an inclusivity database .23
Bibliography .24
iii
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out through
ISO technical committees. Each member body interested in a subject for which a technical committee
has been established has the right to be represented on that committee. International organizations,
governmental and non-governmental, in liaison with ISO, also take part in the work. ISO collaborates closely
with the International Electrotechnical Commission (IEC) on all matters of electrotechnical standardization.
The procedures used to develop this document and those intended for its further maintenance are described
in the ISO/IEC Directives, Part 1. In particular, the different approval criteria needed for the different types
of ISO document should be noted. This document was drafted in accordance with the editorial rules of the
ISO/IEC Directives, Part 2 (see www.iso.org/directives).
ISO draws attention to the possibility that the implementation of this document may involve the use of (a)
patent(s). ISO takes no position concerning the evidence, validity or applicability of any claimed patent
rights in respect thereof. As of the date of publication of this document, ISO had not received notice of (a)
patent(s) which may be required to implement this document. However, implementers are cautioned that
this may not represent the latest information, which may be obtained from the patent database available at
www.iso.org/patents. ISO shall not be held responsible for identifying any or all such patent rights.
Any trade name used in this document is information given for the convenience of users and does not
constitute an endorsement.
For an explanation of the voluntary nature of standards, the meaning of ISO specific terms and expressions
related to conformity assessment, as well as information about ISO's adherence to the World Trade
Organization (WTO) principles in the Technical Barriers to Trade (TBT), see www.iso.org/iso/foreword.html.
This document was prepared by Technical Committee ISO/TC 276, Biotechnology.
Any feedback or questions on this document should be directed to the user’s national standards body. A
complete listing of these bodies can be found at www.iso.org/members.html.
iv
Introduction
A valid database is important for nucleotide sequence evaluation. The development of inclusivity and
exclusivity panels for diagnostics and surveillance using community genomic databases, e.g., Genbank, has
[1],[2],[3]
been evaluated . However, a specific validation procedure for the databases has yet to be provided.
Considering the current database quality, inclusivity and exclusivity are almost impossible to be validated
with ideal accuracy. Therefore, in this document a practical procedure for evaluating the quality of nucleotide
sequence database to be used for the development of inclusivity and exclusivity panels is comprehensively
described. The degree of data accuracy to be used is determined according to the user's intended test
purpose. This evaluation can become a part of the validated diagnostic or surveillance method. Ensuring the
quality of the database improves its sufficiency for validating the whole measuring system.
In polymerase chain reaction (PCR) and DNA microarray technologies, nucleotide sequence is used as
primers or probes to detect the target nucleic acids. Those technologies utilize initially the hybridization of
two single strand DNA molecules with complementary sequences. During the design process of the primers
or probes, nucleotide sequence database is used for evaluating specificity and exclusivity of probes or
primers. In general, target DNA sequences can be confirmed to match the intended sequences but not others
by similarity (homology) search on nucleotide databases with computer tools, for example BLAST.
The validated databases can be used for evaluating specificity of probe or primer sequences and ensuring
the selectivity of the qualification and quantification measurement system.
Validation of the entire nucleotide sequence database is not appropriate for the database providers because
there are wide varieties of purpose of uses by users. It is almost impossible for the users, however, to evaluate
the quality of each data entry especially in huge sequence databases. The database can reflect the fitness for
the intended test purpose of users.
This document provides the minimum requirements of a practical procedure for the validation of database
used for nucleotide sequence evaluation.
v
International Standard ISO 24480:2024(en)
Biotechnology — Validation of database used for nucleotide
sequence evaluation
1 Scope
This document describes a practical procedure for nucleotide sequence database evaluation and validation.
This document describes minimum requirements for the validation of a nucleotide sequence database. This
document is applicable only for databases consisting of entries of nucleotide sequences.
This document is not applicable to the general evaluation of the entire database quality including the quality
of each data entry.
EXAMPLE The use of the validated database is for confirming a representative sequence specificity including
primers or probes for qualification and quantification of target nucleic acids by conventional polymerase chain
reaction (PCR), quantitative polymerase chain reaction (qPCR), digital polymerase chain reaction (dPCR) and
microarray technologies.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content constitutes
requirements of this document. For dated references, only the edition cited applies. For undated references,
the latest edition of the referenced document (including any amendments) applies.
ISO 20691, Biotechnology — Requirements for data formatting and description in the life sciences
3 Terms and definitions
For the purposes of this document, the following terms and definitions apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https:// www .iso .org/ obp
— IEC Electropedia: available at https:// www .electropedia .org/
3.1
nucleotide sequence specificity
capacity to exclusively recognize a specific nucleic acid target sequence, distinguishing it from other nucleic
acids and contaminants
Note 1 to entry: It describes the degree of similarity to specifically match to the nucleotide sequence to be searched by
distinguishing it from other nucleotide sequences, and the tendency for a primer or probe with the matched nucleotide
sequence to hybridize with its intended target and not hybridize with other non-target sequences.
Note 2 to entry: “sequence specificity” can be considered to be the combination of inclusivity (3.4) and exclusivity (3.5)
3.2
selectivity
extent to which a method can determine particular analyte(s) in a mixture(s) or matrice(s) without
interferences from other components of similar behaviour
Note 1 to entry: Selectivity is the recommended term in analytical chemistry to express the extent to which a
particular method can determine analyte(s) in the presence other components. Selectivity can be graded. The use of
the term “specificity” for the same concept is to be discouraged as this often leads to confusion.
Note 2 to entry: Sequence specificity in molecular biomarker analysis is differentiated from chemical analyte
selectivity.
[SOURCE: ISO 16577:2022, 3.3.73]
3.3
sequence similarity
proportion of matched number of units, including nucleotides and amino acids, to the number of units in
specified regions between two nucleic acids or proteins
Note 1 to entry: gap or deletion can be considered to compare the unit sequence of the regions between two nucleic
acids or proteins.
Note 2 to entry: “sequence similarity” can be evaluated simply based on a proportion of matched number of units,
whereas the term “homology” contains biological meaning in the comparison of two nucleic acids or proteins.
3.4
inclusivity
property of a nucleotide sequence to show high sequence similarity (3.3) specifically with intended target
nucleotide sequence
[4]
Note 1 to entry: The term “inclusivity” is used as same meaning of “sensitivity” in some cases .
3.5
exclusivity
property of a nucleotide sequence to show low sequence similarity (3.3) with those excluding intended target
nucleotide sequences
3.6
nucleic acid test
NAT
technique used to detect or quantify a target nucleic acid with specific sequence, by using of oligonucleotide
as a primer or probe
3.7
representative sequence
group of nucleotide sequence data containing one or more target sequences in a complete or partial sequence
intended for detection or quantification
3.8
undesirable sequence
group of nucleotide sequence data containing one or more nucleotide sequences, which are potentially either
influencing or intentionally excluded, or both, for detection or quantification
3.9
intended test purpose
purpose of nucleic acid detection or quantification using oligonucleotide, e.g., primers or probes, whose
design is evaluated by using validated nucleotide sequence databases containing representative and
undesirable sequences (3.8)
3.10
exploring key
data used for examining data entries stored in database
EXAMPLE Key words, sequence data, taxon data, tissue name etc.
3.11
inclusivity database
database used for evaluating inclusivity (3.4) of a specified nucleotide sequence
3.12
exclusivity database
database used for evaluating exclusivity (3.5) of a specified nucleotide sequence
3.13
provenance information
information that documents the history of a described object and related described activities, and that
contains information about the origin or source of the described object, any changes that can have taken
place since it was originated, and who has had custody of it since it was originated
[SOURCE: ISO/TS 23494-1:2023, 3.13]
3.14
finalized provenance information
provenance information transformed into a representation specified by the common provenance model, and
which is prepared to be conserved or archived and which is considered as being immutable
Note 1 to entry: Finalized provenance information is a subset of provenance information.
[SOURCE: ISO/TS 23494-1:2023, 3.5]
3.15
basic local alignment search tool
BLAST
sequence comparison algorithm optimized for speed that is used to search sequence databases for optimal
local alignments to a query
[SOURCE: ISO 20813:2019, 3.1 modified — Notes to entry have been deleted.]
3.16
massively parallel nucleotide sequencing
next generation sequencing
NGS
high throughput nucleotide sequencing method capable of determining multiple DNA sequences
simultaneously and in parallel
Note 1 to entry: The data from a single massively parallel sequencing analysis comprises of millions of sequences and
the output is a file containing all sequences.
[SOURCE: ISO 16577:2022, 3.7.10, modified —"whole genome sequencing" and "WGS" have been deleted.]
4 General
There are significant differences between the inclusivity and exclusivity confirmation roles. A database
used for the inclusivity analysis shall cover all intended sequence entries. In addition, other recognized
unintended sequence entries should be contained to show the sequence similarity is specific to the intended
sequence entries in a recognized extent, although exclusivity cannot be confirmed only with the recognized
undesirable sequences. Entries with high and reliable quality of both intended sequences and recognized
[3]
undesirable sequences should be included in the database . Quality of the sequence entries for inclusivity
analysis is described in the validation of inclusivity database.
On the other hand, a database used for exclusivity analysis should include as many sequence entries
as possible including related and not likely related ones. Even though the entries are not likely related
sequences, the database should present those sequences because they can contain sequences that can be
unintentionally hybridized by the primers or probes in non-specific manner and rise the amplification
background. The quality of the sequence entries for the exclusivity analysis is described in the validation
of the exclusivity database (for details, see 7.3). One example for uses of a validated database is for an in
silico analysis evaluating nucleotide sequence specificity in designing primers or probes for nucleic acid
measurement including various PCR-based methods and microarray analysis, i.e., inclusivity and exclusivity
analyses. Databases for the inclusivity analysis are used for evaluation on how the designed primers and
probes can work to distinguish a target in the nucleic acid measurement methods. A database for the
exclusivity analysis is used for evaluating the possibility of the designed primers and probes showing non-
specific detection or quantification in the nucleic acid measurement methods. Therefore, when users validate
a database, i.e., confirm that the requirements of the database for a specific intended use have been fulfilled,
they shall validate the database by fulfilling the requirements with those two roles, namely inclusivity and
exclusivity confirmations.
Thus, users can specify two independent databases fitting to the two roles in many cases. There are specific
requirements for databases used for inclusivity evaluation (inclusivity database) and databases used for
exclusivity evaluation (exclusivity database) depending on the roles (see Clause 6 and Clause 7). It does not
limit, however, to place both roles in one database. In some cases, the inclusivity database and the exclusivity
database can be the same, for example, when the nucleic acid measurement method is used in specified
environment where the available nucleotide sequences are well characterized and limited.
5 Common requirements of the database
[8]
Databases should implement the FAIR principles . When constructing databases, they shall be constructed
in accordance with ISO 20691. Each entry shall be identified with appropriate identifier(s), for example,
scientific name, accession number for registered sequence in public database, unique number with
authorship for the non-registered sequence. The data format of the database shall be machine-readable
[7]
and generated in as accessible format for nucleotide sequence analysis, for example, fasta or fastq format
(see Annex A). The database shall be accessible by search functions, for example, local BLAST search, taxon
search, text search of gene names.
NOTE In some cases, inter-jurisdictional consideration is important, depending on the characteristics of data
entries.
6 Inclusivity database: database for inclusivity evaluation
6.1 Quality criteria
Quality criteria for each data entry in inclusivity database shall be determined by the user, considering the
intended test purpose of the NAT.
An example of a whole validation process for an inclusivity database is described in Annex B.
6.2 Requirements of an inclusivity database
High quality target sequences, which are intended to be detected or quantified by the NAT measurement
system, shall be sufficiently populated in the inclusivity database with numbers of the representative
sequences to cover sequence discrimination by the measurement system.
Entries shall include representative sequences of the target and sequences that are undesirable to be
detected by the measurement system, for showing that the sequence similarity is specific to the intended
sequence entries to a recognized extent (see Annex E as an example for dataset verification commands).
Representative sequences of the target should be stored in multiple entries, for example, the sequences of a
target analysed by several different laboratories.
NOTE Redundancy of the sequences in the database can be allowed.
The inclusivity database shall contain sequences with high sequence similarity (species specific and non-
specific; target to be included or excluded) based on criteria determined by users.
Users should take into account to include sequences with point mutations when applicable. In some cases,
sequences from the same taxonomic rank such as genus, species, subspecies, homologous genes, or variants
can be selected as sequences with high sequence similarity.
6.3 Individual data quality indicators
6.3.1 Data provenance and updates
The inclusivity database can be updated periodically. The updated database shall be validated by following
the procedures described in this document. Date and time of the update shall be documented.
When database entries are documented using finalized provenance information according to the ISO 23494
series, the collected finalized provenance information can be used for quality assessment of the entries. The
finalized provenance information can be the most significant indicator for the quality assessment.
6.3.2 Length of the entries
The entries in the database shall have appropriate length, which needs to be longer than the minimum
length of the nucleotide sequence specified by the database user within the quality criteria.
NOTE Data entries with short sequences, such as raw data of NGS can be impeditive to the interpretation of
results of the evaluation for validation and actual use of the database, for example, primer and probe design.
Long nucleotide sequences, such as long contigs and whole genome sequence data, which are outside of
the maximum quality criteria should be excluded. Although longer sequences are useful for the exclusivity
evaluation, which is the main purpose of exclusivity database usage (see below), they are less applicable for
validation of inclusivity database, primer and probe design and the evaluation of their inclusivity.
6.3.3 Number of unidentified nucleotides (N)
The nucleotide sequence quality should meet certain criteria when incorporating NGS data into the
inclusivity database because NGS data, especially raw data, have not only a short length of the nucleotide
sequence (see 6.3.2) but also a higher possibility of deletion and ambiguous data (for example, unassigned
data marked as “N”).
NOTE Quality Value in FASTQ data format can be used for estimating whether database entries can be used in the
inclusivity database.
6.4 Validation of the inclusivity database
The validation plan of the inclusivity database shall be established, implemented and documented.
The validation of the inclusivity database is the result of confirming whether each data entry is appropriate
or not to be included in the database. Therefore, each data entry in the inclusivity database should be
confirmed by human curation to ensure that it fulfils the determined quality criteria. In cases where human
curation is used, it shall be performed at the early stage of the inclusivity database validation to verify data
entries, i.e., target genes and species, entries format, length of sequence, and literature references. When the
human curation is eliminated in the validation, an alternative procedure to confirm the conformity of each
data entry shall be used and documented.
During validation, the quality of the inclusivity database can be confirmed by searching it with representative
[5]
sequences and evaluating the number of correct and incorrect best matches . Some quality indicators and
[6]
methods for the evaluation are described in the previous report .
The validation search procedure for the inclusivity database shall be able to retrieve correct best matches of
the representative sequence and related entries.
The inclusivity database shall be accessible to users and can be retrieved in a popular format with correct
header, nucleotide sequence, length of sequence which can be analysed using tools such as local BLAST
search. Thereby, the quality of sequence entries, i.e., perfect match and mismatch of the representative
sequence such as highly similar sequences (>99 % similarity), can be confirmed.
7 Exclusivity database: Database for the exclusivity evaluation
7.1 Quality criteria
The user shall determine the criteria for the exclusivity database to evaluate its coverage, i.e., the
representative and undesirable data and how the database sufficient for the exclusivity evaluation. Quality
criteria should be indicated with consistent information (e.g., number of entries, sequence length as many as
possible to draw conclusions of the validation results).
The user shall also document exploring keys to confirm whether sufficient entries for the exclusivity
evaluation are contained in the database.
EXAMPLE Nucleotide sequence, gene name, variant identification including isoform names, gene family name,
functional ontology, and taxon data are examples that can be set for the exploring keys.
These criteria and exploring keys vary depending on the purpose of database.
The example of a whole validation process of an exclusivity database is described in Annex C.
7.2 Requirements of the exclusivity database
For the exclusivity database, as many as possible database(s) containing sufficient sequence data related to
representative and undesirable data shall be selected. The sufficient number of entries varies depending on
the purpose of exclusivity database usage. Taxonomic variation shall be included as much as possible in the
exclusivity database depending on the purpose.
The developer(s) or user(s) shall determine the data quality parameters, including but not limited to the
following:
a) sequence length;
b) predicted sequence;
c) number of sequences;
d) redundancy;
e) number of unidentified nucleotides (N).
NGS data, especially raw data, have short and higher possibility of deletion and ambiguous data (for example,
unassigned data marked “N”). Nucleotide sequence quality should meet certain criteria when incorporating
NGS data into the exclusivity database in common with the inclusivity database (see 6.3.2).
For the exclusivity database, preparing a subset database or narrowing down by searching with a specific
selection of parameters, e.g., excluding short sequences or synthetic oligo nucleotides, or key words such
as the gene family name or disease name can be specified for validation, verification and actual use for
designing primers or probes.
The exclusivity database shall contain nucleotide sequences of species that are presumably relevant to the
representative sequence and purpose of the intended test purpose of the NAT.
EXAMPLE 1 Sequence from the same taxonomic rank such as class “mammal”, and genus / species “homo sapiens”
The exclusivity database shall contain nucleotide sequence(s) of unrelated species documented in the
inclusivity database. These entries are critical for evaluating exclusivity.
EXAMPLE 2 Sequence from different taxonomic rank such as kingdom (plant or fungus, phylogenetically) far
different from target species.
7.3 Validation of the exclusivity database
The validation plan of the exclusivity database shall be established, implemented and documented.
The validation search procedure for the exclusivity database shall be performed by executing a query
with representative sequences and determined exploring keys. The selected type and version of database
including date and time of execution shall be documented.
By querying with representative sequences, the target sequences and its closely related sequences, for
example, variant, isoforms, and homologues, can be retrieved and confirmed as entries in the exclusivity
database. Hence, the quality of sequence entries, i.e., perfect match and mismatch of the representative
sequence such as highly similar sequences (>99 % similarity) or less similar sequences (<99 % similarity)
can be observed and verified.
By querying with exploring keys, the related sequences that need to be discriminated can be retrieved and
confirmed as entries in the exclusivity database. The number of these entries is critical for the purpose of
the exclusivity database usage, namely the evaluation of exclusivity.
In contrast with the validation of the inclusivity database, human curation comes at the later stage prior to
validation of the exclusivity database. A human curation should be performed to verify data entries, i.e., the
exclusivity of target genes and species, the format of entries, and literature references.
Throughout the validation processes, the interpretation of the search results is most important. The
strategy for the interpretation shall be described and documented in the validation plan, and the results
of the interpretation shall be documented with objective evidence sufficient for the conclusion. Scientific
references describing the representative sequences and circumjacent information, e.g., in the field of
comparative biology, can be useful for showing the reason of the conclusion of interpretation.
EXAMPLE To develop the NAT for detection of subtype H1N1 of influenza virus, an exclusivity database is valid if
the database includes not only target sequences, e.g., influenza H1N1, but also related genes undesirable to be detected,
e.g., H3 for HA, N2 for NA sequences of influenza, rhinovirus and corona virus.
For the NAT for the detection of animal species targeting rRNA, the exclusivity database shall contain all
available sequences of rRNA.
The exclusivity database can be validated if the database includes not only major animal sequences, but also
contains other eukaryotes such as fungus and plant rRNA.
8 Validation report
The validation report shall include, but not be limited to, the following:
a) the date of the report;
b) the intended test purpose of the NAT;
c) the inclusivity database validation plan including quality criteria, and representative sequences used;
d) the results of the inclusivity database validation;
e) the exclusivity database validation plan including the procedure to confirm the conformity of each
data entry, when human curation cannot be applied, quality criteria, exploring keys used, the version of
database used and date and time of execution;
f) the results of the exclusivity database validation;
g) a reference to this document, i.e., ISO 24480:2024;
h) any deviations from the procedure;
i) any unusual features observed;
j) the date of the validation.
The validation report can be stored in a digital format in the same location with the validated inclusivity
database and validation files for exclusivity database.
The example for whole processes to use inclusivity and exclusivity databases that is helpful for verifying the
requirements of the validation report is described in Annex D.
Annex A
(informative)
Example of a data entry format
A.1 Basics of nucleotide sequence databases
In the nucleotide sequence databases that can be used for conforming a representative sequence specificity
including primers or probes for qualification and quantification of target nucleic acids, each entry is
identified with appropriate identifier(s), such as scientific name, accession number for registered sequence
in public database, unique number with authorship for the non-registered sequence. The data format of the
database is generated in an accessible format for nucleotide sequence analysis, e.g., fasta or fastq format. A
database can have search interfaces for users and can be searchable by search functions, for example, local
BLAST search, taxon search, text search of gene names.
A.2 Examples of data entry
A.2.1 Valid example
>NM_001001491.2 Mus musculus tropomyosin 4 (Tpm4), mRNA
ACCGCAAGTATGAGGAGGTTGCTCGTAAGTTGGTCATCCTGGAGGGTGAGCT GAAGAGAGCAGAGGAG
AGGGCGGAGGTATCTGAACT AAAGTGTGGTGACCTGGAAGAAGAGCTCAAGA ATGTAACTAACAATCT
GAAATCACTGGAGGCTGCTTCTGAA
A.2.2 Non-valid example
The following sequences has no header or not in an applicable format (for example, fasta)
>
ACCGCAAGTATGAGGAGGTTGCTCGTAAGTTGGTCATCCTGGAGGGTGAGCT GAAGAGAGCAGAGGAG
AGGGCGGAGGTATCTGAACT AAAGTGTGGTGACCTGGAAGAAGAGCTCAAGA ATGTAACTAACAATCT
GAAATCACTGGAGGCTGCTTCTGAA
>ACCGCAAGTATGAGGAGGTTGCTCGTAAGTTGGTCATCCTGGAGGGTGAGCT GAAGAGAGCAGAGGA
GAGGGCGGAGGTATCTGAACT AAAGTGTGGTGACCTGGAAGAAGAGCTCAAGA ATGTAACTAACAATC
TGAAATCACTGGAGGCTGCTTCTGAA
Annex B
(informative)
Example for the validation of an inclusivity database (Inclusivity)
B.1 General
This annex describes an example for the validation of the inclusivity database for an inclusivity evaluation.
This example starts with raw data processing, including human curation and validation, ends with validated
inclusivity database as final output.
B.2 Inclusivity database validation workflow
The workflow for inclusivity database validation is shown in Figure B.1.
Figure B.1 — Inclusivity database validation workflow (adopted from Methodology for data
[6]
validation 1.0
B.3 Inclusivity database validation plan
B.3.1 Intended test purpose of NAT
Detection and identification of Tropomyosin (TPM) isoforms in rodent.
B.3.2 Acceptance criteria
— Database contains the target and its homologous sequences.
— Database contains more than four isoforms of Tropomyosin.
— Data entry is in fasta format. Entry should contain header.
— Length of sequence should be more than 1 000 bases.
— Random search target nt sequence is not required.
— Local BLAST search should be applicable.
B.4 Purpose of database usage
Evaluate inclusivity of primer sequence to detect specific TPM gene in rodent.
B.5 Data entry
Below is the example of Tropomyosin and Troponin genes dataset from mouse, rat and human.
>NM_001164255.1 Mus musculus tropomyosin 1, alpha (Tpm1), transcript variant Tpm1.10, mRNA
>NM_001164256.1 Mus musculus tropomyosin 1, alpha (Tpm1), transcript variant Tpm1.12, mRNA
>NM_001293748.1 Mus musculus tropomyosin 3, gamma (Tpm3), transcript variant 2, mRNA
>NM_001253738.1 Mus musculus tropomyosin 3, gamma (Tpm3), transcript variant 3, mRNA
>NM_001001491.2 Mus musculus tropomyosin 4 (Tpm4), mRNA
>NM_001277903.1 Mus musculus troponin T1, skeletal, slow (Tnnt1), transcript variant 1, mRNA
>NM_001130178.2 Mus musculus troponin T2, cardiac (Tnnt2), transcript variant 5, mRNA
>NM_011620.3 Mus musculus troponin T3, skeletal, fast (Tnnt3), transcript variant 7, mRNA
>NM_001301336.1 Rattus norvegicus tropomyosin 1 (Tpm1), transcript variant Tpm1.1, mRNA
>NM_001301736.1 Rattus norvegicus tropomyosin 1 (Tpm1), transcript variant Tpm1.12, mRNA
>NM_173111.1 Rattus norvegicus tropomyosin 3 (Tpm3), transcript variant Tpm3.1, mRNA
>NM_001301285.1 Rattus norvegicus tropomyosin 3 (Tpm3), transcript variant Tpm3.12, mRNA
>M34136.1 Rat brain alpha-tropomyosin (TMBr-3) mRNA, 3' end
>NM_012676.1 Rattus norvegicus troponin T2, cardiac type (Tnnt2), mRNA
>NM_001270673.1 Rattus norvegicus troponin T3, fast skeletal type (Tnnt3), transcript variant 7, mRNA
>NM_001018006.2 Homo sapiens tropomyosin 1 (TPM1), transcript variant Tpm1.7, mRNA
>NM_003289.4 Homo sapiens tropomyosin 2 (TPM2), transcript variant Tpm2.2, mRNA
>NM_001278188.2 Homo sapiens tropomyosin 3 (TPM3), transcript variant 6, mRNA
>NM_001367837.2 Homo sapiens tropomyosin 4 (TPM4), transcript variant 4, mRNA
>NM_001126133.3 Homo sapiens troponin T1, slow skeletal type (TNNT1), transcript variant 3, mRNA
>NM_001276345.2 Homo sapiens troponin T2, cardiac type (TNNT2), transcript variant 5, mRNA
>NM_001367850.1 Homo sapiens troponin T3, fast skeletal type (TNNT3), transcript variant 15, mRNA
B.6 Human curation
Example for a list of scientific publication for each entry.
>NM_001164255.1 Mus musculus tropomyosin 1, alpha (Tpm1), transcript variant Tpm1.10, mRNA
PubMed ID: 32376900, 30700554, 30642949, 30567734, 30242109, 25369766, 7522680, 1631061,
2521606, 3244365
>NM_001001491.2 Mus musculus tropomyosin 4 (Tpm4), mRNA
PubMed ID: 28134622, 25369766, 19118250, 18270576, 18036591, 17968984, 16765662, 16236705
>NM_001277903.1 Mus musculus troponin T1, skeletal, slow (Tnnt1), transcript variant 1, mRNA
PubMed ID: 32059926, 31148174, 30979776, 29931346, 11003710, 10594179, 10449439, 10095098,
9651500, 9107680
>NM_001301336.1 Rattus norvegicus tropomyosin 1 (Tpm1), transcript variant Tpm1.1, mRNA
PubMed ID: 30462572, 28002632, 25369766, 24362038, 23609439, 23420843, 2022655, 2320008,
3352602, 3558368
>NM_001301285.1 Rattus norvegicus tropomyosin 3 (Tpm3), transcript variant Tpm3.12, mRNA
PubMed ID: 28677753, 25369766, 22749829, 22114352, 21036167, 20458337, 9473354, 8674141,
7704029, 8206382
>NM_012676.1 Rattus norvegicus troponin T2, cardiac type (Tnnt2), mRNA
PubMed ID: 32297828, 25771144, 24364879, 23357173, 23012479, 7898523, 8205619, 1433301,
2530435, 2760070
>NM_003289.4 Homo sapiens tropomyosin 2 (TPM2), transcript variant Tpm2.2, mRNA
PubMed ID: 32957762, 31487691, 30545627, 30535593, 25369766, 20301465, 20301436, 1631061,
1304342, 2059197
>NM_001367837.2 Homo sapiens tropomyosin 4 (TPM4), transcript variant 4, mRNA
PubMed ID: 32296183, 29455030, 28431393, 28330616, 28134622, 25369766, 1286667, 1836432,
3612796, 3865200
>NM_001367850.1 Homo sapiens troponin T3, fast skeletal type (TNNT3), transcript variant 15, mRNA
PubMed ID: 29596868, 26774798, 26915936, 25342443, 23936387, 18629027, 8681137, 8062920,
8172653, 7118902
B.7 Inclusivity database validation
The inclusivity database is validated according to the following criteria:
— Target sequence with regards to target animals and genes (passed/failed)
— Related entries with minimum four isoforms of Tropomyosin (passed/failed)
— Applicability for local BLAST search (passed/failed)
When all criteria are passed, the inclusivity database is valid and can be used for the inclusivity evaluation.
An example of use of inclusivity database is shown in Annex D.
Annex C
(informative)
Example on validation of an exclusivity database (Exclusivity)
C.1 General
This annex describes the example on validation of exclusivity database for exclusivity evaluation. This
example includes quality criteria determination, database selection, validation, and validated exclusivity
database as final output.
C.2 Exclusivity database validation workflow
Detection and identification of Tropomyosin (TPM) isoforms in rodent.
The workflow for exclusivity database validation is shown in Figure C.1.
Figure C.1 — Exclusivity database validation workflow
C.3 Exclusivity database validation plan
C.3.1 Intended test purpose of NAT
— Detection and identification of Tropomyosin family from various animals, including rodents and human.
— Homologous genes, i.e., Troponin are included.
C.3.2 Acceptance criteria
— Database contains the representative sequence and its homologous sequences from various species
and taxon.
— Database contains all four isoforms of Tropomyosin as set in the exploring keys.
C.4 Purpose of database usage
Evaluate exclusivity of primer sequence to detect specific TPM 4 gene in rodent.
C.5 Database selection
Below are the examples of selected databases:
— GenBank nucleotide collection (nr/nt)
— GenBank Protein Data Bank nucleotide (PDBnt)
— GenBank Expressed Sequence Tags (dbEST)
C.6 Exclusivity database validation
C.6.1 General
Database selection, exploring key search, and BLAST search, were performed on November 26, 2020. All
data were obtained on the same date.
C.6.2 Results of exploring key search
Number of selected sequences using Entrez nucleotide query (exploring key: tropomyosin OR tpm OR
troponin) resulted in 137 474 entries including from animals, plants, fungi, protists, bacteria, archaea,
and viruses. According to the acceptance criteria, all isoforms of Tropomyosin, i.e., Tropomyosin 1,
Tropomyosin 2, Tropomyosin 3, Tropomyosin 4 and other genes, i.e., Troponin were confirmed and therefore,
the exploring key was acceptable.
C.6.3 Results of representative sequence search in BLAST
C.6.3.1 Results using GenBank nucleotide collection (nr/nt) database
The result of sequence similarity verified by GenBank nucleotide collection (nr/nt) database with
NM_001001491.2 complete sequence is shown in Table C.1.
Table C.1 — Sequence similarity of NM_001001491.2 complete sequence
Query E Per. Acc.
Description Accession
cover Value Ident Len
Mus musculus tropomyosin 4 (Tpm4), mRNA 100 % 0,0 100 2 099 NM_001001491.2
Mus musculus tropomyosin 4, mRNA (cDNA clone
MGC:95675. 99 % 0,0 100 2 109 BC070421.1
Mus musculus tropomyosin 4, mRNA (cDNA clone
MGC:38384. 99 % 0,0 99,33 2 118 BC023701.1
Mus musculus cDNA clone IMAGE:5322101, containing
frame-shift. 99 % 0,0 99,28 2 107 BC032174.1
Mus musculus cDNA clone IMAGE:5322155 99 % 0,0 99,28 2 106 BC032175.1
[10][11]
NOTE Explanations of query cover, E value and percent identity can be found in .
TTabablele C C.11 ((ccoonnttiinnueuedd))
Query E Per. Acc.
Description Accession
cover Value Ident Len
Mus musculus tropomyosin 4, mRNA (cDNA clone
MGC:38326. 98 % 0,0 99,42 2 082 BC023827.2
PREDICTED: Mus car
...



