ISO/DTS 24910-2
(Main)Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method
General Information
- Abstract
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of hazelnut - specific DNA derived from food. PCR amplification reactions in which sufficient amounts of DNA are extracted from the relevant substrate can be used to detect the genetic material of hazelnuts, including hazelnut (Corylus heterophylla) and hazelnut (Corylus avellana). The assay also detects the Corylus heterophylla × Corylus avellana. The target sequence is a partially fragment of the hazelnut (Corylus heterophylla) major allergen Cor h 1 gene and hazelnut (Corylus avellana) major allergen Cor a 1 gene (GenBank accession number EU195058.1 for Cor h 1 and GenBank accession number AF323975.1 for Cor a 1). The provided PCR assay for this target has an absolute detection limit of 5 copies per reaction, with ≥ 95 % reproducibility at this concentration (LOD95%).
- Status
- Not Published
- Technical Committee
- ISO/TC 34/SC 16 - Horizontal methods for molecular biomarker analysis
- Drafting Committee
- ISO/TC 34/SC 16 - Horizontal methods for molecular biomarker analysis
- Current Stage
- 5020 - FDIS ballot initiated: 2 months. Proof sent to secretariat
- Start Date
- 25-Sep-2026
- Completion Date
- 25-Sep-2026
Buy Documents
ISO/DTS 24910-2 - Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method
REDLINE ISO/DTS 24910-2 - Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method
Overview
ISO/DTS 24910-2: Molecular biomarker analysis - Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) - Part 2: Hazelnut DNA detection method is an international standard developed by ISO/TC 34/SC 16. This document details a real-time polymerase chain reaction (PCR) protocol for the qualitative detection of hazelnut-specific DNA in food products. The standard is focused on the presence of hazelnut (Corylus heterophylla and Corylus avellana) and their hybrids, by targeting conserved fragments of the major allergen genes Cor h 1 and Cor a 1.
Accurate detection of hazelnut DNA is crucial for food safety, allergen management, and prevention of food fraud. Real-time PCR offers high sensitivity, specificity, and reproducibility, making it suitable for routine laboratory testing of plant-derived allergens in complex food matrices.
Key Topics
- Hazelnut DNA Detection: Specifies a qualitative PCR-based assay targeting key allergenic marker genes to identify hazelnut-derived genetic material in food, even at trace levels.
- Sensitivity and Specificity: The assay reliably detects as few as five DNA copies per reaction with ≥ 95% reproducibility (LOD95%). Primers and probes are designed to be highly specific, with no cross-reactivity to other food plants.
- Internal Controls: Incorporates an endogenous reference gene (eukaryotic 18S rRNA) as a control for DNA quality and PCR reaction integrity, ensuring result validity.
- Sample Preparation: Outlines best practices for sample homogenization and DNA extraction to maximize the yield of amplifiable DNA.
- Quality Assurance: Includes protocols for positive, negative, and inhibition controls, as well as repeatability and robustness validation to ensure reliable results across laboratories.
Applications
ISO/DTS 24910-2 is designed for laboratories, food manufacturers, regulatory authorities, and quality assurance professionals. Use cases include:
- Food Allergen Label Verification: Ensuring regulatory compliance for food products labeled as “hazelnut-free.” Real-time PCR detection supports risk assessment and protects sensitive consumers.
- Contamination Monitoring: Detecting unintended presence of hazelnut DNA due to cross-contact in production facilities, thereby enhancing HACCP programs.
- Food Fraud Prevention: Authenticating food ingredient declarations and identifying economically motivated adulteration.
- Allergen Quantification Support: While qualitative, the method can underpin more detailed quantitative assessments if needed.
- Import and Export Controls: Laboratories can use the method for routine monitoring in accordance with international food trade requirements.
The protocol leverages widely accepted PCR instrumentation and reagents, allows for harmonization across testing labs, and supports the growing emphasis on molecular techniques in food safety.
Related Standards
For comprehensive coverage in molecular biomarker analysis and food authenticity, consider the following related ISO standards:
- ISO 20813 - Molecular biomarker analysis - Methods of analysis for detection and identification of animal species in foods (nucleic acid-based methods).
- ISO 21571 - Foodstuffs - Methods for the detection of genetically modified organisms and derived products - Nucleic acid extraction.
- ISO 24276 - Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - General requirements and definitions.
- ISO 20688-1 - Biotechnology - Nucleic acid-based synthesis - Requirements for the production and quality control of synthesized oligonucleotides.
- ISO 16577 - Vocabulary for molecular biomarker analytical methods in agriculture and food production.
Adopting these standards alongside ISO/DTS 24910-2 helps laboratories maintain robust, up-to-date molecular testing strategies for food safety and compliance.
By implementing ISO/DTS 24910-2, organizations strengthen controls over allergen management and food authenticity, ensuring consumer safety and regulatory compliance through validated molecular biomarker analysis.
Buy Documents
ISO/DTS 24910-2 - Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method
REDLINE ISO/DTS 24910-2 - Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method
Get Certified
Connect with accredited certification bodies for this standard

BSI Group
BSI (British Standards Institution) is the business standards company that helps organizations make excellence a habit.

Bureau Veritas
Bureau Veritas is a world leader in laboratory testing, inspection and certification services.

DNV
DNV is an independent assurance and risk management provider.
Sponsored listings
Frequently Asked Questions
ISO/DTS 24910-2 is a draft published by the International Organization for Standardization (ISO). Its full title is "Molecular biomarker analysis — Detection of plant-derived materials in food by real-time polymerase chain reaction (PCR) — Part 2: Hazelnut DNA detection method". This standard covers: This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of hazelnut - specific DNA derived from food. PCR amplification reactions in which sufficient amounts of DNA are extracted from the relevant substrate can be used to detect the genetic material of hazelnuts, including hazelnut (Corylus heterophylla) and hazelnut (Corylus avellana). The assay also detects the Corylus heterophylla × Corylus avellana. The target sequence is a partially fragment of the hazelnut (Corylus heterophylla) major allergen Cor h 1 gene and hazelnut (Corylus avellana) major allergen Cor a 1 gene (GenBank accession number EU195058.1 for Cor h 1 and GenBank accession number AF323975.1 for Cor a 1). The provided PCR assay for this target has an absolute detection limit of 5 copies per reaction, with ≥ 95 % reproducibility at this concentration (LOD95%).
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of hazelnut - specific DNA derived from food. PCR amplification reactions in which sufficient amounts of DNA are extracted from the relevant substrate can be used to detect the genetic material of hazelnuts, including hazelnut (Corylus heterophylla) and hazelnut (Corylus avellana). The assay also detects the Corylus heterophylla × Corylus avellana. The target sequence is a partially fragment of the hazelnut (Corylus heterophylla) major allergen Cor h 1 gene and hazelnut (Corylus avellana) major allergen Cor a 1 gene (GenBank accession number EU195058.1 for Cor h 1 and GenBank accession number AF323975.1 for Cor a 1). The provided PCR assay for this target has an absolute detection limit of 5 copies per reaction, with ≥ 95 % reproducibility at this concentration (LOD95%).
ISO/DTS 24910-2 is classified under the following ICS (International Classification for Standards) categories: 67.050 - General methods of tests and analysis for food products. The ICS classification helps identify the subject area and facilitates finding related standards.
ISO/DTS 24910-2 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.
Standards Content (Sample)
FINAL DRAFT
Technical
Specification
ISO/TC 34/SC 16
Molecular biomarker analysis —
Secretariat: ANSI
Detection of plant-derived materials
Voting begins on:
in food by real-time polymerase
2026-09-25
chain reaction (PCR) —
Voting terminates on:
2026-11-20
Part 2:
Hazelnut DNA detection method
Analyse de biomarqueurs moléculaires — Détection de matières
d’origine végétale dans les aliments par polymérisation en chaîne
(PCR) en temps réel —
Partie 2: Méthode de détection de l’ADN de noisette
RECIPIENTS OF THIS DRAFT ARE INVITED TO SUBMIT,
WITH THEIR COMMENTS, NOTIFICATION OF ANY
RELEVANT PATENT RIGHTS OF WHICH THEY ARE AWARE
AND TO PROVIDE SUPPOR TING DOCUMENTATION.
IN ADDITION TO THEIR EVALUATION AS
BEING ACCEPTABLE FOR INDUSTRIAL, TECHNO-
LOGICAL, COMMERCIAL AND USER PURPOSES, DRAFT
INTERNATIONAL STANDARDS MAY ON OCCASION HAVE
TO BE CONSIDERED IN THE LIGHT OF THEIR POTENTIAL
TO BECOME STAN DARDS TO WHICH REFERENCE MAY BE
MADE IN NATIONAL REGULATIONS.
Reference number
FINAL DRAFT
Technical
Specification
ISO/TC 34/SC 16
Molecular biomarker analysis —
Secretariat: ANSI
Detection of plant-derived materials
Voting begins on:
in food by real-time polymerase
chain reaction (PCR) —
Voting terminates on:
Part 2:
Hazelnut DNA detection method
Analyse de biomarqueurs moléculaires — Détection de matières
d’origine végétale dans les aliments par polymérisation en chaîne
(PCR) en temps réel —
Partie 2: Méthode de détection de l’ADN de noisette
RECIPIENTS OF THIS DRAFT ARE INVITED TO SUBMIT,
WITH THEIR COMMENTS, NOTIFICATION OF ANY
RELEVANT PATENT RIGHTS OF WHICH THEY ARE AWARE
AND TO PROVIDE SUPPOR TING DOCUMENTATION.
© ISO 2026
IN ADDITION TO THEIR EVALUATION AS
All rights reserved. Unless otherwise specified, or required in the context of its implementation, no part of this publication may
BEING ACCEPTABLE FOR INDUSTRIAL, TECHNO-
LOGICAL, COMMERCIAL AND USER PURPOSES, DRAFT
be reproduced or utilized otherwise in any form or by any means, electronic or mechanical, including photocopying, or posting on
INTERNATIONAL STANDARDS MAY ON OCCASION HAVE
the internet or an intranet, without prior written permission. Permission can be requested from either ISO at the address below
TO BE CONSIDERED IN THE LIGHT OF THEIR POTENTIAL
or ISO’s member body in the country of the requester.
TO BECOME STAN DARDS TO WHICH REFERENCE MAY BE
MADE IN NATIONAL REGULATIONS.
ISO copyright office
CP 401 • Ch. de Blandonnet 8
CH-1214 Vernier, Geneva
Phone: +41 22 749 01 11
Email: copyright@iso.org
Website: www.iso.org
Published in Switzerland Reference number
ii
Contents Page
Foreword .iv
Introduction .v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 Scientific basis . 2
5 Reagents and materials . 2
6 Apparatus . 3
7 Procedure . 3
7.1 Preparation of the test portion/sample .3
7.2 Preparation of DNA extracts .3
7.3 PCR setup.3
7.3.1 Reaction mixes .3
7.3.2 PCR controls .4
7.3.3 Real-time PCR thermocycler plate set-up.4
7.4 Temperature-time programme.4
8 Accept/reject criteria . 5
8.1 General .5
8.2 Identification .5
9 Validation status and performance criteria . 6
9.1 General .6
9.2 Internal validation.6
9.2.1 Robustness . .6
9.2.2 Sensitivity .6
9.2.3 Specificity .8
9.2.4 Repeatibility .11
9.2.5 Actual sample measurement .11
9.3 Collaborative validation between laboratories . 12
9.3.1 Reproducibility . 12
9.3.2 Sensitivity . 13
10 Test report . 14
Annex A (informative) BlastN 2.14.0 results for query of GenBank refseq-genomes (6 databases) .15
Bibliography .18
iii
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out through
ISO technical committees. Each member body interested in a subject for which a technical committee
has been established has the right to be represented on that committee. International organizations,
governmental and non-governmental, in liaison with ISO, also take part in the work. ISO collaborates closely
with the International Electrotechnical Commission (IEC) on all matters of electrotechnical standardization.
The procedures used to develop this document and those intended for its further maintenance are described
in the ISO/IEC Directives, Part 1. In particular, the different approval criteria needed for the different types
of ISO document should be noted. This document was drafted in accordance with the editorial rules of the
ISO/IEC Directives, Part 2 (see www.iso.org/directives).
ISO draws attention to the possibility that the implementation of this document may involve the use of (a)
patent(s). ISO takes no position concerning the evidence, validity or applicability of any claimed patent
rights in respect thereof. As of the date of publication of this document, ISO had not received notice of (a)
patent(s) which may be required to implement this document. However, implementers are cautioned that
this may not represent the latest information, which may be obtained from the patent database available at
www.iso.org/patents. ISO shall not be held responsible for identifying any or all such patent rights.
Any trade name used in this document is information given for the convenience of users and does not
constitute an endorsement.
For an explanation of the voluntary nature of standards, the meaning of ISO specific terms and expressions
related to conformity assessment, as well as information about ISO’s adherence to the World Trade
Organization (WTO) principles in the Technical Barriers to Trade (TBT), see www.iso.org/iso/foreword.html.
This document was prepared by Technical Committee ISO/TC 34, Food products, Subcommittee SC 16,
Horizontal methods for molecular biomarker analysis.
A list of all parts in the ISO 24910 series can be found on the ISO website.
Any feedback or questions on this document should be directed to the user’s national standards body. A
complete listing of these bodies can be found at www.iso.org/members.html.
iv
Introduction
Hazelnuts are plant-based materials that contain allergens. Hazelnut allergies involve reactions to proteins
such as pathogen-related protein PR-10, consisting of the Cor a1 allergen, profilin (Cor a2), non-specific lipid
transfer protein (LTP) (Cor a 8), oleosin (Cor a 12, Cor a 13, and Cor a 15), 2S albumin (Cor a 14), 11S globulin/
[1]
legumin (Cor a 9), and 7S globulin/vicilin (Cor a 11). Fraudulent adulteration of plant-derived ingredients
in food can be accidental or economically motivated. This document provides a real-time polymerase chain
reaction (PCR) assay method for the identification of plant component species from nucleic acids present in
[2]
food ingredients.
Plant-derived biological materials in food are detected and identified in the laboratory with the following
successive (or simultaneous) steps:
— preparation of the test portion/sample;
— nucleic acid extraction and purification;
— PCR amplification;
— interpretation of results.
This document provides guidance for the reporting of PCR amplification and hazelnut DNA test results.
v
FINAL DRAFT Technical Specification ISO/DTS 24910-2:2026(en)
Molecular biomarker analysis — Detection of plant-derived
materials in food by real-time polymerase chain reaction
(PCR) —
Part 2:
Hazelnut DNA detection method
1 Scope
This document specifies a real-time polymerase chain reaction (PCR) method for the qualitative detection
of hazelnut-specific DNA derived from food. It includes extraction of an adequate amount of PCR-amplifiable
DNA from the relevant matrix.
This document is applicable to the detection of genetic material from hazelnuts, including hazelnut (Corylus
heterophylla) and hazelnut (Corylus avellana). The assay also detects the Corylus heterophylla × Corylus
avellana hybrid.
The target sequence corresponds to a conserved fragment shared between the major allergen isoforms
Cor h 1 gene of Corylus heterophylla (GenBank accession: EU195058.1) and Cor a 1 gene of Corylus avellana
[3][4]
(GenBank accession: AF323975.1) located on the C a 1 chromosome. There are multiple copies of both
[5]
Cor a 1 and Cor h 1 Genes. The PCR assay provided for this target has an absolute limit of detection (LOD)
of five copies per reaction, with a 95 % confidence limit (LOD ).
95%
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content constitutes
requirements of this document. For dated references, only the edition cited applies. For undated references,
the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
ISO 20688-1:2020, Biotechnology — Nucleic acid synthesis — Part 1: Requirements for the production and
quality control of synthesized oligonucleotides
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of animal
species in foods and food products (nucleic acid-based methods) — General requirements and definitions
ISO 21571, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and derived
products — Nucleic acid extraction
ISO 24276, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and derived
products — General requirements and definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https:// www .iso .org/ obp
— IEC Electropedia: available at https:// www .electropedia .org/
4 Scientific basis
[6]
DNA is extracted from the test portion by applying a suitable method (see ISO 21571:2005 , Clause A.1).
The DNA analysis consists of the following two parts:
— verification of the quality and PCR amplifiability of the extracted DNA using a real-time PCR assay
[7]
targeting an endogenous marker reference gene for eukayotes (e.g. eukaryotic 18S rRNA );
NOTE The 18S rRNA gene is a highly conserved, foundational component of eukaryotic ribosomes, acting as a
crucial, universally applicable internal control for qPCR, gene expression normalization and phylogenetic studies.
A highly conserved sequence of the 18S rRNA gene was chosen as the quality and PCR amplifiability control.
— detection of the hazelnut-species-specific DNA sequences of the Corylus heterophylla major allergen Cor h
1 gene and Corylus avellana major allergen Cor a 1 gene (Cor h 1 GenBank accession number EU195058.1
and Cor a 1 GenBank accession number FJ358504.1) in a real-time PCR.
5 Reagents and materials
For this document, only chemicals and water of recognized analytical grade, appropriate for molecular
biology, shall be used. Unless stated otherwise, solutions should be prepared by dissolving the corresponding
reagents in water followed by autoclave sterilization. For all operations in which gloves are used, gloves shall
be powder free. Aerosol-protected pipette tips should be used (protection against cross-contamination).
5.1 PCR master mix, a pre-mixed, concentrated ready to use solution (2X) containing thermo-stable (heat
resistant) DNA polymerase, KCl, MgCl , four dNTPs (dATP, dCTP, dGTP, dTTP) and buffer excluding primers,
probes and template.
5.2 Oligonucleotides.
The quality of the oligonucleotides shall be sufficient for their use as primers and probes in accordance with
ISO 20688-1:2020. See Table 1.
Table 1 — Oligonucleotides
Name DNA sequence of the oligonucleotide Final concentration in
PCR
a
Cor h1 and Cor a1 as the target sequences (GenBank accession number EU195058.1 and AF323975.1)
Hazelnut-102bp-F 5ʹ- GGAACCATCAAGAAGATC -3ʹ 400 nmol/l
Hazelnut-102 bp-R 5ʹ- GCTGTAGCAGTATTTGAA -3ʹ 400 nmol/l
b
Hazelnut-102 bp-P 5ʹ- [FAM]- TCTCCTCAACCTTGTGCTTCATGTA - [BHQ1] -3′ 200 nmol/l
Primers targeting the Phaseoleae environmental sample clone Elev_18S_1274 18S ribosomal RNA gene (GenBank
c
accession: EF024772.1 )
a
PCR product = 154-GGAACCATCA AGAAGATCAC CTTCGCCGAA GGCAACGAAT TCAAGTACAT GAAGCACAAG GTTGAGGAGA
TCGACCACGC AAACTTCAAA TACTGCTACA GC-255-EU195058.1 and AF323975.1. See Annex A.
b
FAM: 6-carboxyfluorescein, BHQ: non-fluorescent quencher minor groove binder.
c
PCR product = 394 - CCTGAGAAAC GGCTACCACA TCCAAGGAAG GCAGCAGGCG CGCAAATTAC CCAATCCTAA CACG – 457 -
EF024772.1.
d
FAM: 6-carboxyfluorescein,BHQ,non-fluorescent quencher minor groove binder.
NOTE 1 Hazelnut-102bp-F is base pairs 530-548, Hazelnut-102bp-R is base pairs 598-621 and Hazelnut-102bp - P is 199-223 of
EU195058.1 Cor h 1 gene and AF323975.1 Cor a 1 gene in chromosome Ca1. Equivalent reporter dyes and/or quencher dyes can be
used if they yield the same or better results.
NOTE 2 18S-F is the 394-411 base pair of the EF024772.1 Phaseoleae environmental sample clone Elev_18S_1274 18S ribosomal
RNA gene on GenBank, 18S-R is the 439-457 base pair and 18S-P is the 418-437 base pair.
TTabablele 1 1 ((ccoonnttiinnueuedd))
Name DNA sequence of the oligonucleotide Final concentration in
PCR
18S--43 bp-F 5ʹ- CCTGAGAAACGGCTACCA -3ʹ 400 nmol/l
18S--43 bp--R 5ʹ- CGTGTCAGGATTGGGTAAT -3ʹ 400 nmol/l
d
18S--43 bp-P 5ʹ-[FAM] - TGCGCGCCTGCTGCCTTCCT - [BHQ] -3ʹ 400 nmol/l
a
PCR product = 154-GGAACCATCA AGAAGATCAC CTTCGCCGAA GGCAACGAAT TCAAGTACAT GAAGCACAAG GTTGAGGAGA
TCGACCACGC AAACTTCAAA TACTGCTACA GC-255-EU195058.1 and AF323975.1. See Annex A.
b
FAM: 6-carboxyfluorescein, BHQ: non-fluorescent quencher minor groove binder.
c
PCR product = 394 - CCTGAGAAAC GGCTACCACA TCCAAGGAAG GCAGCAGGCG CGCAAATTAC CCAATCCTAA CACG – 457 -
EF024772.1.
d
FAM: 6-carboxyfluorescein,BHQ,non-fluorescent quencher minor groove binder.
NOTE 1 Hazelnut-102bp-F is base pairs 530-548, Hazelnut-102bp-R is base pairs 598-621 and Hazelnut-102bp - P is 199-223 of
EU195058.1 Cor h 1 gene and AF323975.1 Cor a 1 gene in chromosome Ca1. Equivalent reporter dyes and/or quencher dyes can be
used if they yield the same or better results.
NOTE 2 18S-F is the 394-411 base pair of the EF024772.1 Phaseoleae environmental sample clone Elev_18S_1274 18S ribosomal
RNA gene on GenBank, 18S-R is the 439-457 base pair and 18S-P is the 418-437 base pair.
6 Apparatus
Requirements concerning apparatus and materials shall follow ISO 20813 and ISO 24276. In addition to the
usual laboratory equipment, the following equipment is shall be used.
6.1 Real-time thermocycler instrument, which amplifies DNA in vitro and performs the temperature-
time cycles for PCR. In addition, the device shall be capable of exciting fluorescence molecules at specific
wavelengths and detecting sufficient emitted fluorescent light of the fluorophore used to perform TaqMan
format assays.
7 Procedure
7.1 Preparation of the test portion/sample
The test sample used for DNA extraction shall be representative of the laboratory sample and homogeneous
(e.g. by grinding or homogenizing the laboratory sample to a fine mixture). Test portion and sample
preparation shall follow the general requirements and specific methods in accordance with ISO 21571 and
ISO 20813.
7.2 Preparation of DNA extracts
The extraction/purification and quantification of DNA from the test portion shall follow the general
requirements and methods provided in ISO 21571. DNA extraction methods in accordance with
[6]
ISO 21571:2005 , Annex A, should be used.
7.3 PCR setup
7.3.1 Reaction mixes
The method is for a total volume of 25 μl per PCR. The reaction setup is given in Table 2. Reagents shall
be completely thawed at room temperature. Each reagent shall be carefully mixed and briefly centrifuged
immediately before pipetting. A PCR reagent mixture is prepared to contain all components except for the
sample DNA. The required total amount of the PCR reagent mixture prepared depends on the number of
reactions to be performed, including at least one additional reaction as a pipetting reserve. The number of
sample and control replicates shall follow ISO 20813. Set up the PCR tests as follows:
a) mix the PCR reagent mixture, centrifuge briefly and pipette 23 μl into each reaction vial;
b) add 2 μl of each sample DNA (20 ng/μl to 200 ng/μl) or positive DNA target control or extraction blank
control or water to the respective reaction vials;
c) mix and centrifuge briefly.
Table 2 — Reaction setup for the amplification
Parameter Value
µl
Total reaction volumes 25
Sample DNA (20 ng/μl to 200 ng/μl) or controls 2
a
2X PCR master mix 12,5
b
Primer hazelnut -102 bp-F, c=10 μmol/l 1,0
b
Primer hazelnut -102 bp-R, c=10 μmol/l 1,0
b
Probe hazelnut -102 bp-P, c=10 μmol/l 1,0
ddH 0 to 25
a
In the collaborative trial, a ready-to-use optimized 2X PCR master mix containing all of the components, excluding the
template and primers, was used. The 2X PCR reaction mixture contained a mixture of thermostable (heat-resistant) DNA
polymerase, a blend of dNTPs with dUTP and uracil-UDG to minimize carry-over PCR contamination and a passive internal
reference based on ROX dye. Equivalent products can be used if they yield the same or better results. The total reaction system
volume of the real-time fluorescence PCR is 25 μl. Reagent quantity and the temperature-time programme can be adjusted
according to different manufacturers’ reagents and real-time fluorescence PCR instruments.
b
The primer and probe concentrations for 18S ribosomal RNA were consistent with those used for hazelnut.
7.3.2 PCR controls
7.3.2.1 General
PCR controls shall be in accordance with ISO 24276 and ISO 20813.
7.3.2.2 Inhibition control (reference gene assay)
A reference control gene (e.g. 18S rRNA gene for eukaryotes) PCR assay using sample DNAs shall be
performed to test nucleic acid amplifiability and provide control to exclude false-negative results.
7.3.3 Real-time PCR thermocycler plate set-up
Transfer the setup reaction vials to the thermocycler. The vials should be arranged to avoid any possible
edge temperature variations associated with a particular real-time thermocycler instrument. Start the
temperature-time programme.
7.4 Temperature-time programme
The temperature-time programme as outlined in Table 3 was used in the validation study. The use of
different reaction conditions and real-time PCR cycles shall be verified. Amplification of the endogenous
reference gene was likewise carried out using the temperature-time programme given in Table 3.
Table 3 — Temperature-time programme
Step Parameter Temperature Time Fluorometer Cycles
measurement
1 Initial denaturation 95 °C 10 min No 1
Denaturation 95 °C 15 s No
2 Amplification 45
Annealing and elongation 60 °C 60 s Yes
8 Accept/reject criteria
8.1 General
A corresponding real-time PCR-instrument-specific data analysis programme shall be used for the
[8]
identification of PCR products. The amplification results can be expressed differently, depending on
the instrument used. In the absence of detectable PCR products (e.g.
...
ISO/TC 34/SC 16
ISO/CD TS 24910-2(en)
Secretariat: ANSI
Date: 2026-09-11
Molecular biomarker analysis — Detection of plant-derived
materials in food by real-time polymerase chain reaction (PCR) —
Part 2:
Hazelnut DNA detection method
Analyse de biomarqueurs moléculaires — Détection de matières d'origined’origine végétale dans les aliments
par polymérisation en chaîne (PCR) en temps réel —
Partie 2: Méthode de détection de l'ADNl’ADN de noisette
All rights reserved. Unless otherwise specified, or required in the context of its implementation, no part of this publication
may be reproduced or utilized otherwise in any form or by any means, electronic or mechanical, including photocopying,
or posting on the internet or an intranet, without prior written permission. Permission can be requested from either ISO
at the address below or ISO’s member body in the country of the requester.
ISO copyright office
CP 401 • Ch. de Blandonnet 8
CH-1214 Vernier, Geneva
Phone: + 41 22 749 01 11
E-mail: copyright@iso.org
Website: www.iso.org
Published in Switzerland
ii
Contents
Foreword . iv
Introduction . v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 Scientific basis . 2
5 Reagents and materials . 2
6 Apparatus . 3
7 Procedure . 3
7.1 Preparation of the test portion/sample . 3
7.2 Preparation of DNA extracts . 3
7.3 PCR setup . 4
7.4 Temperature-time programme . 5
8 Accept/reject criteria . 5
8.1 General. 5
8.2 Identification . 5
9 Validation status and performance criteria . 6
9.1 General. 6
9.2 Internal validation . 6
9.3 Collaborative validation between laboratories . 13
10 Test report . 15
Annex A (informative) BlastN 2.14.0 results for query of GenBank refseq-genomes
(6 databases) . 16
Bibliography . 19
iii
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out through
ISO technical committees. Each member body interested in a subject for which a technical committee has been
established has the right to be represented on that committee. International organizations, governmental and
non-governmental, in liaison with ISO, also take part in the work. ISO collaborates closely with the
International Electrotechnical Commission (IEC) on all matters of electrotechnical standardization.
The procedures used to develop this document and those intended for its further maintenance are described
in the ISO/IEC Directives, Part 1. In particular, the different approval criteria needed for the different types of
ISO documentsdocument should be noted. This document was drafted in accordance with the editorial rules
of the ISO/IEC Directives, Part 2 (see www.iso.org/directives).
ISO draws attention to the possibility that the implementation of this document may involve the use of (a)
patent(s). ISO takes no position concerning the evidence, validity or applicability of any claimed patent rights
in respect thereof. As of the date of publication of this document, ISO [had/had not] received notice of (a)
patent(s) which may be required to implement this document. However, implementers are cautioned that this
may not represent the latest information, which may be obtained from the patent database available at
www.iso.org/patents. ISO shall not be held responsible for identifying any or all such patent rights.
Any trade name used in this document is information given for the convenience of users and does not
constitute an endorsement.
For an explanation of the voluntary nature of standards, the meaning of ISO specific terms and expressions
related to conformity assessment, as well as information about ISO'sISO’s adherence to the World Trade
Organization (WTO) principles in the Technical Barriers to Trade (TBT), see www.iso.org/iso/foreword.html.
This document was prepared by Technical Committee ISO/TC 34, Food products, Subcommittee SC 16,
Horizontal methods for molecular biomarker analysis.
A list of all parts in the ISO 24910 series can be found on the ISO website.
Any feedback or questions on this document should be directed to the user'suser’s national standards body. A
complete listing of these bodies can be found at www.iso.org/members.html.
iv
Introduction
Hazelnuts are plant-based materials that contain allergens. Hazelnut allergies involve reactions to proteins
likesuch as pathogen-related protein PR-10, consisting of the Cor a1 allergen, profilin (Cor a2), non-specific
lipid transfer protein (LTP) (Cor a 8), oleosin (Cor a 12, Cor a 13, and Cor a 15), 2S albumin (Cor a 14), 11S
[1]
globulin/legumin (Cor a 9), and 7S globulin/vicilin (Cor a 11) .). Fraudulent adulteration of plant-derived
ingredients in food can be accidental or economically motivated. This document provides a real-time
polymerase chain reaction (real-time PCR) assay method for the identification of plant component species
[2]
from nucleic acids present in food ingredients .
Plant-derived biological materials in food are detected and identified in the laboratory with the following
successive (or simultaneous) steps:
— preparation of the test portion/sample, ;
— nucleic acid extraction and purification, ;
— PCR amplification and ;
— interpretation of results.
This document provides guidance for the reporting of PCR amplification and hazelnut DNA test results.
New plant species DNA detection methods established in the future will be added as independent parts.
v
Molecular biomarker analysis — Detection of plant-derived materials
in food by real-time polymerase chain reaction (PCR) —
Part 2:
Hazelnut DNA detection method
1 Scope
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative
detection of hazelnut-specific DNA derived from food. It requiresincludes extraction of an adequate amount
of PCR-amplifiable DNA from the relevant matrix and can be applied.
This document is applicable to the detection of genetic material from hazelnuts, including hazelnut (Corylus
heterophylla) and hazelnut (Corylus avellana). The assay also detects the Corylus heterophylla × Corylus
avellana hybrid.
The target sequence corresponds to a conserved fragment shared between the major allergen isoforms Cor h
1 gene of Corylus heterophylla (GenBank accession: EU195058.1) and Cor a 1 gene of Corylus avellana
, [3] [4]
(GenBank accession: AF323975.1) located on the C a 1 chromosome . There are multiple copies of both
[5]
Cor a 1 and Cor h 1 Genes. The PCR assay provided for this target has an absolute limit of detection (LOD)
of five copies per reaction, with a 95 % confidence limit (LOD ).
95%
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content constitutes
requirements of this document. For dated references, only the edition cited applies. For undated references,
the latest edition of the referenced document (including any amendments) applies.
ISO 20813:201916577, Molecular biomarker analysis — Methods of analysis for the detection and identification
of animal species in foodsVocabulary for molecular biomarker analytical methods in agriculture and food
products (nucleicproduction
ISO 20688-1:2020, Biotechnology — Nucleic acid-based methods) — General requirements and definitions
synthesis — Part 1: Requirements for the production and quality control of synthesized oligonucleotides
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of animal
species in foods and food products (nucleic acid-based methods) — General requirements and definitions
ISO 21571:2005, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and
derived products — Nucleic acid extraction
ISO 24276, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and derived
products — General requirements and definitions
ISO 24276:2006, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and
derived products — General requirements and definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminologicalterminology databases for use in standardization at the following
addresses:
— ISO Online browsing platform: available at https://www.iso.org/obphttps://www.iso.org/obp
— IEC Electropedia: available at https://www.electropedia.org/https://www.electropedia.org/
4 Scientific basis
[6]
DNA is extracted from the test portion by applying a suitable method (see ISO 21571:2005 methodISO
21571:2005 ., Clause A.1). The DNA analysis consists of the following two parts:
— verification of the quality and PCR amplifiability of the extracted DNA using a real-time PCR assay targeting
[7]
an endogenous marker reference -gene for eukayotes (e.g. eukaryotic 18S rRNA ));
NOTE The 18S rRNA gene is a highly conserved, foundational component of eukaryotic ribosomes, acting as a
crucial, universally applicable internal control for qPCR, gene expression normalization, and phylogenetic studies. A
highly conserved sequence of the 18S rRNA gene was chosen as the quality and PCR amplifiability control.
— detection of the hazelnut-species-specific DNA sequences of the Corylus heterophylla major allergen Cor h
1 gene and Corylus avellana major allergen Cor a 1 gene (Cor h 1 GenBank accession number EU195058.1
and Cor a 1 GenBank accession number FJ358504.1) in a real-time PCR.
5 Reagents and materials
5.1 General
For this document, only chemicals and water of recognized analytical grade, appropriate for molecular
biology, shall be used. Unless stated otherwise, solutions should be prepared by dissolving the corresponding
reagents in water followed by autoclave sterilization. For all operations in which gloves are used, gloves shall
be powder free. The use of aerosol Aerosol-protected pipette tips should be used (protection against cross-
contamination) is recommended.).
5.2 PCR reagents
5.2.1 PCR master mix
5.35.1 The PCR master mix is, a pre-mixed, concentrated ready to use solution (2X) containing thermo-
stable (heat resistant) DNA polymerase, KCl, MgCl , four dNTPs (dATP, dCTP, dGTP, dTTP) and buffer
excluding primers, probes and template.
5.45.2 Oligonucleotides.
The quality of the oligonucleotides shall be sufficient for their use as primers and probes in accordance with
ISO 20688-1:2020. See Table 1.
Table 1 — Oligonucleotides
Name DNA sequence of the oligonucleotide Final concentration in
PCR
a
Cor h1 and Cor a1 as the target sequences (GenBank accession number EU195058.1 and AF323975.1 ) )
Hazelnut-102bp-F 5'5ʹ- GGAACCATCAAGAAGATC -3'3ʹ 400 nmol/l
Hazelnut-102 bp-R 5'5ʹ- GCTGTAGCAGTATTTGAA -3'3ʹ 400 nmol/l
b
Hazelnut-102 bp-P 5'5ʹ- [FAM]- TCTCCTCAACCTTGTGCTTCATGTA - [BHQ1] -3′ 200 nmol/l
Name DNA sequence of the oligonucleotide Final concentration in
PCR
Primers targeting the Phaseoleae environmental sample clone Elev_18S_1274 18S ribosomal RNA gene (GenBank
c
accession: EF024772.1 )
18S--43 bp-F 5'5ʹ- CCTGAGAAACGGCTACCA -3'3ʹ 400 nmol/l
18S--43 bp--R 5'5ʹ- CGTGTCAGGATTGGGTAAT -3'3ʹ 400 nmol/l
d
18S--43 bp-P 5'5ʹ-[FAM] - TGCGCGCCTGCTGCCTTCCT - [BHQ] -3'3ʹ 400 nmol/l
a
PCR product= = 154-GGAACCATCA AGAAGATCAC CTTCGCCGAA GGCAACGAAT TCAAGTACAT GAAGCACAAG GTTGAGGAGA
TCGACCACGC AAACTTCAAA TACTGCTACA GC-255-EU195058.1 and AF323975.1. See Annex A.
b
FAM: 6-carboxyfluorescein, BHQ: non-fluorescent quencher minor groove binder.
c
PCR product= = 394- - CCTGAGAAAC GGCTACCACA TCCAAGGAAG GCAGCAGGCG CGCAAATTAC CCAATCCTAA CACG– – 457- -
EF024772.1.
d
FAM:: 6-carboxyfluorescein,BHQ:non-fluorescent quencher minor groove binder.
NOTE 1NOTE 1 Hazelnut-102bp-F is base pairs 530-548, Hazelnut-102bp-R is base pairs 598-621, and Hazelnut-102bp - P is
199-223 of EU195058.1 Cor h 1 gene and AF323975.1 Cor a 1 gene in chromosome Ca1. Equivalent reporter dyes and/or quencher
dyes can be used if they yield the same or better results.
NOTE 2NOTE 2 18S-F is the 394-411 base pair of the EF024772.1 Phaseoleae environmental sample clone Elev_18S_1274 18S
ribosomal RNA gene on GenBank, 18S-R is the 439-457 base pair, and 18S-P is the 418-437 base pair.18S-F is the 394-411 base pair
of the EF024772.1 Phaseoleae environmental sample clone Elev_18S_1274 18S ribosomal RNA gene on GenBank, 18S-R is the 439-
457 base pair, and 18S-P is the 418-437 base pair.
6 Apparatus
Requirements concerning apparatus and materials shall follow ISO 20813 and ISO 24276. In addition to the
usual laboratory equipment, the following equipment is requiredshall be used.
6.1 Real-time thermocycler instrument
6.26.1 A device that, which amplifies DNA in vitro and performs the temperature-time cyclesshall be
usedcycles for PCR. AdditionallyIn addition, the device shall be capable of exciting
fluorophoresfluorescence molecules at specific wavelengths and detecting sufficient emitted fluorescent
light of the fluorophore used to perform TaqMan format assays.
7 Procedure
7.1 Preparation of the test portion/sample
The test sample used for DNA extraction shall be representative of the laboratory sample and homogeneous,
(e.g. by grinding or homogenizing the laboratory sample to a fine mixture.). Test portion and sample
preparation shall follow the general requirements and specific methods described in accordance with ISO
21571:2005 and ISO 20813:2019.
7.2 Preparation of DNA extracts
The extraction/purification and quantification of DNA from the test portion shall follow the general
requirements and methods provided in ISO 21571:2005. DNA extraction methods described in accordance
[6]
with ISO 21571:2005 ISO 21571:2005 are recommended, Annex A, should be used.
7.3 PCR setup
7.3.1 Reaction mixes
The method is for a total volume of 25 μl per PCR. The reaction setup is given in Table 2. Reagents shall be
completely thawed at room temperature. Each reagent shall be carefully mixed and briefly centrifuged
immediately before pipetting. A PCR reagent mixture is prepared to contain all components except for the
sample DNA. The required total amount of the PCR reagent mixture prepared depends on the number of
reactions to be performed, including at least one additional reaction as a pipetting reserve. The number of
sample and control replicates shall follow ISO 20813. Set up the PCR tests as follows:
a) mix the PCR reagent mixture, centrifuge briefly and pipette 23 μl into each reaction vial;
b) add 2 μl of each sample DNA (20 ng/μl to 200 ng/μl) or positive DNA target control or extraction blank
control or water to the respective reaction vials;
c) mix and centrifuge briefly.
Table 2 — Reaction setup for the amplification
Parameter Value
µl
Total reaction volumes 25 µl
Sample DNA (20 ng/μl to 200 ng/μl) or controls 2 µl
a
2 ×2X PCR master mix 12,5 µl
b b
Primer Hazelnuthazelnut -102 bp-F, c=10 μmol/l l 1,0 µl
b b
Primer Hazelnuthazelnut -102 bp-R, c=10 μmol/l l 1,0 µl
b b
Probe Hazelnuthazelnut -102 bp-P, c=10 μmol/l l 1,0 µl
ddH 0 to 25 µl
a
In the collaborative trial, a ready-to-use optimized 2×2X PCR master mix containing all of the components, excluding the
template and primers, was used. The 2×2X PCR reaction mixture contained a mixture of thermostable (heat-resistant) DNA
polymerase, a blend of dNTPs with dUTP and uracil-UDG to minimize carry-over PCR contamination, and a passive internal
reference based on ROX dye. Equivalent products can be used if they yield the same or better results. The total reaction system
volume of the real-time fluorescence PCR is 25 μl. Reagent quantity and the temperature-time programprogramme can be adjusted
according to different manufacturers'manufacturers’ reagents and real-time fluorescence PCR instruments.
b
The primer and probe concentrations for 18S ribosomal RNA were consistent with those used for hazelnut.
7.3.2 PCR controls
7.3.2.1 General
PCR controls shall be as described in accordance with ISO 24276:2006 and ISO 20813:2019 .
7.3.2.2 Inhibition control (reference gene assay)
A reference control gene (e.g. 18S rRNA gene for eukaryotes) PCR assay using sample DNAs shall be performed
to test nucleic acid amplifiability and provide control to exclude false-negative results.
7.3.3 Real-time PCR thermocycler plate set-up
Transfer the setup reaction vials to the thermocycler. The vials should be arranged to avoid any possible edge
temperature variations associated with a particular real-time thermocycler instrument. Start the
temperature-time programme.
7.4 Temperature - -time programme
The temperature-time programme as outlined in Table 3 was used in the validation study. The use of different
reaction conditions and real-time PCR cycles shall be verified. Amplification of the endogenous reference gene
was likewise carried out using the temperature–-time programme given in Table 3 .
Table 3 — Temperature-time programme
Step Temperatu Time Fluorometer Cycles
ParemeterParameter
re measurement
1 Initial denaturation 95 °C 10 min No 1
Denaturation 95 °C 15 s No
2 Amplification 45
Annealing and elongation 60 °C 60 s Yes
8 Accept/reject criteria
8.1 General
A corresponding real-time PCR-instrument-specific data analysis programme shall be used for the
[8]
identification of PCR products . The amplification results can be expressed differently, depending on the
instrument used. In the absence of detectable PCR products (e.g. negative controls), the result shall be
expressed as "“undetermined", "”, “no amplification"” or the maximum number of reaction cycles performed.
If amplification of the DNA target sequence in a sample (e.g. positive controls) occurred, a sigmoid-shaped
amplification curve is observed. The cycle number at the crossing point of the amplification curve and the
fluorescence threshold shall be calculated [cycle threshold (Ct) or cycle quantification (Cq)].
If, due to atypical fluorescence measurement data, the automatic interpretation does not provide a meaningful
result, it willcan be necessary to set the baseline and the threshold manually prior to interpreting the data. In
such a case, the device-specific instructions provided with the interpretation software shall be followed.
8.2 Identification
The target sequence is considered as detected if:
— hazelnut-specific primers Hazelnut -102 bp-F and Hazelnut -102 bp-R and the probe Hazelnut -102 bp-P
produce a sigmoid-shaped amplification curve and a C value or C value can be calculated;
t q
— PCR control reactions with no added DNA (PCR reagent control, extraction blank control) produce no
amplification;
— Thethe amplification controls (positive DNA target control, internal reference gene control) produce the
expected amplification and Ct values (or Cq values);
— Ifif the endogenous reference gene 18S rRNA fails to exhibit a logarithmic fluorescence increase, no typical
amplification curve appears in the fluorescence channel, and no C (or C ) value is generated—, after ruling
t q
out operational errors in DNA extraction—, it can be concluded that the absence of the target gene
detection is attributed to DNA inhibition or degradation in the sample extract.
Trace detections are defined as PCRs with C values later than that defined at the target LOD . In the event
t 95%
of a trace detection or contradictory positive/negative results from different extracts of the same sample, the
sample shall be retested. At least two new extracts shall be prepared from the homogenized laboratory sample.
A minimum of twenty PCR replicates shall be conducted across the new extracts [e.g. ten PCR repeats for two
extracted DNA, seven PCR repeats for three extracted DNA]. The target sequence shall be considered as
"“detected"” if ≥95% of the new extract PCR results show a positive detection.
If the PCR result of re-extracting DNA is less than 95 % positive, and the internal reference gene 18S rRNA
shows specific fluorescence logarithmic growth, typical amplification curves in the fluorescence channel, and
Ct (or Cq) values, the target sequence is considered "“undetected".”.
9 Validation status and performance criteria
9.1 General
Validation followed athe following two-part process:
[9]
a) in-house validation (see ISO 11781:2025 ;);
[2] [10] [11]
b) collaborative trial validation : .
9.2 Internal validation
9.2.1 Robustness
The robustness of the method was confirmed for the collaborative trial using plasmid pMD19-T-hcq as a
reference sample, by changing the reaction conditions f
...







