ISO/TS 12869:2012

Water quality - Detection and quantification of Legionella spp. and/or Legionella pneumophila by concentration and genic amplification by quantitative polymerase chain reaction (qPCR)

ISO/TS 12869:2012 specifies a method for the detection and quantification of Legionella spp. and L. pneumophila using a quantitative polymerase chain reaction (qPCR). It specifies general methodological requirements, performance evaluation requirements, and quality control requirements. Technical details specified in ISO/TS 12869:2012 are given for information only. Any other technical solutions complying with the performance requirements are suitable. ISO/TS 12869:2012 is intended to be applied in the bacteriological investigation of all types of water (both hot and cold), unless the nature and/or content of suspended matter and/or accompanying flora interfere with the determination. This interference can result in an adverse effect on both the detection limit and the quantification limit. The results are expressed as the number of genome units of Legionella spp. and/or L. pneumophila per litre of sample. The method described in ISO/TS 12869:2012 is applicable to all types of water. However, some additives, e.g. chemicals used for water treatment, can interfere with and/or affect the sensitivity of the method. The qPCR methods do not give any information about live or dead cells.

Qualité de l'eau — Détection et quantification de Legionella spp. et/ou Legionella pneumophila par concentration et amplification génique par réaction de polymérisation en chaîne quantitative (qPCR)

Kakovost vode - Ugotavljanje prisotnosti in števila Legionella spp. in/ali Legionella pneumophila s koncentriranjem in pomnoževanjem genov s kvantitativno verižno reakcijo s polimerazo (qPCR)

To tehnično poročilo podaja metodo za ugotavljanje prisotnosti in števila Legionella spp. in Legionella pneumophila s kvantitativno verižno reakcijo s polimerazo (qPCR). Določa splošne metodološke zahteve, zahteve za ocenjevanje delovanja in zahteve za nadzor kakovosti. Tehnične podrobnosti, navedene v tem tehničnem poročilu, so izključno informativne. Vse druge tehnične rešitve, ki so skladne z zahtevami za delovanje, so ustrezne.

General Information

• Status: Withdrawn
• Publication Date: 17-Oct-2012
• Withdrawal Date: 17-Oct-2012
• ICS: 07.100.20 - Microbiology of water
• Technical Committee: ISO/TC 147/SC 4 - Microbiological methods
• Drafting Committee: ISO/TC 147/SC 4/WG 17 - Legionella by PCR
• Current Stage: 9599 - Withdrawal of International Standard
• Start Date: 01-Apr-2019
• Completion Date: 13-Dec-2025
• Ref Project: SIST-TS ISO/TS 12869:2013 - Water quality - Detection and quantification of Legionella spp. and/or Legionella pneumophila by concentration and genic amplification by quantitative polymerase chain reaction (qPCR)

Relations

• Revised: ISO/TS 12869:2019 - Water quality - Detection and quantification of Legionella spp. and/or Legionella pneumophila by concentration and genic amplification by quantitative polymerase chain reaction (qPCR)
• Effective Date: 06-Feb-2016

Standards Content (Sample)

TECHNICAL ISO/TS
SPECIFICATION 12869
First edition
2012-11-01
Water quality — Detection and
quantification of Legionella spp.
and/or Legionella pneumophila by
concentration and genic amplification
by quantitative polymerase chain
reaction (qPCR)
Qualité de l’eau — Détection et quantification de Legionellaa spp. et/ou
Legionellaa pneumophilaa par concentration et amplification génique
par réaction de polymérisation en chaîne quantitative (qPCR)
Reference number
©
ISO 2012
© ISO 2012
All rights reserved. Unless otherwise specified, no part of this publication may be reproduced or utilized in any form or by any
means, electronic or mechanical, including photocopying and microfilm, without permission in writing from either ISO at the
address below or ISO’s member body in the country of the requester.
ISO copyright office
Case postale 56 • CH-1211 Geneva 20
Tel. + 41 22 749 01 11
Fax + 41 22 749 09 47
E-mail [e-mail]
Web www.iso.org
Published in Switzerland
ii © ISO 2012 – All rights reserved

Contents Page
Foreword .iv
Introduction .v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 Principle . 4
5 Sampling . 4
6 General testing conditions . 5
6.1 General . 5
6.2 Staff . 5
6.3 Premises . 5
6.4 Apparatus and consumables (excluding reagents) . 5
6.5 Reagents. 6
6.6 Decontamination of equipment and premises . 8
6.7 Treatment and elimination of waste . 8
7 Procedure. 8
7.1 Concentration. 8
7.2 DNA extraction . 8
7.3 DNA amplification by PCR . 9
7.4 Quantitative detection .10
8 Expression of the results .12
9 Test report .12
10 Technical protocol for the characterization and the validation of the method .13
10.1 General .13
10.2 Inclusivity and exclusivity of probes and primers .14
10.3 Verification of the calibration function of the quantitative PCR phase .14
10.4 Verification of the PCR limit of quantification, LQ .
qPCR 19
10.5 Verification of the PCR limit of detection (LDqPCR) .21
10.6 Recovery method .21
10.7 Robustness .22
10.8 Measurement uncertainty of the whole method .23
11 Quality controls .23
11.1 General .23
11.2 Connecting the calibration solution and the reference material to the primary standard 24
11.3 Monitoring of the performances .26
11.4 Positive and negative controls of the method .26
11.5 PCR reagent blank .26
11.6 Inhibition control .26
Annex A (informative) Example of protocol for producing a quantitative standard DNA solution .29
Annex B (informative) Example of method for determining the cycle threshold .30
Annex C (informative) Example of a study of the quantitative PCR phase calibration function .32
Annex D (informative) Specific Student distribution .35
Annex E (informative) Example of recovery evaluation .36
Annex F (informative) Example of overall uncertainty evaluation .37
Annex G (normative) Evaluation of the performances of a third party validated method .38
Bibliography .39
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out
through ISO technical committees. Each member body interested in a subject for which a technical
committee has been established has the right to be represented on that committee. International
organizations, governmental and non-governmental, in liaison with ISO, also take part in the work.
ISO collaborates closely with the International Electrotechnical Commission (IEC) on all matters of
electrotechnical standardization.
International Standards are drafted in accordance with the rules given in the ISO/IEC Directives, Part 2.
The main task of technical committees is to prepare International Standards. Draft International
Standards adopted by the technical committees are circulated to the member bodies for voting.
Publication as an International Standard requires approval by at least 75 % of the member bodies
casting a vote.
In other circumstances, particularly when there is an urgent market requirement for such documents, a
technical committee may decide to publish other types of document:
— an ISO Publicly Available Specification (ISO/PAS) represents an agreement between technical
experts in an ISO working group and is accepted for publication if it is approved by more than 50 %
of the members of the parent committee casting a vote;
— an ISO Technical Specification (ISO/TS) represents an agreement between the members of a
technical committee and is accepted for publication if it is approved by 2/3 of the members of the
committee casting a vote.
An ISO/PAS or ISO/TS is reviewed after three years in order to decide whether it will be confirmed for
a further three years, revised to become an International Standard, or withdrawn. If the ISO/PAS or
ISO/TS is confirmed, it is reviewed again after a further three years, at which time it must either be
transformed into an International Standard or be withdrawn.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. ISO shall not be held responsible for identifying any or all such patent rights.
ISO/TS 12869 was prepared by Technical Committee ISO/TC 147, Water quality, Subcommittee SC 4,
Microbiological methods.
iv © ISO 2012 – All rights reserved

Introduction
This Technical Specification specifies a method for the detection and quantification of Legionella species
(spp.) and Legionella pneumophila (L. pneumophila) in water using a quantitative polymerase chain
reaction (qPCR).
The presence of L. pneumophila or Legionella spp. in water samples is demonstrated and quantified by
amplifying DNA sequences (PCR) with specific oligonucleotides. Specificity of the detection is ensured
by using a target sequence specific fluorescent-labelled probe. The increase in the amount of the DNA
amplicon can be measured and visualized in real time by a quantitative PCR device with fluorophore
specific filters.
A calibration curve is used for quantification purposes. The guidelines, minimum requirements and
performance characteristics are intended to guarantee that the results are reliable and reproducible
between different laboratories.
This Technical Specification specifies a determination of the recovery of the DNA extraction. The
performance of the extraction procedure is not fully covered (lysis efficiency is not estimated).
TECHNICAL SPECIFICATION ISO/TS 12869:2012(E)
Water quality — Detection and quantification of Legionella
spp. and/or Legionella pneumophila by concentration
and genic amplification by quantitative polymerase chain
reaction (qPCR)
WARNING — Legionella spp. can be handled safely by experienced microbiologists on the open
bench in a conventional microbiology laboratory conforming to containment level 2. Infection
is caused by inhalation of the organism; hence it is advisable to assess all techniques for their
ability to produce aerosols. If in doubt, carry out the work in a safety cabinet.
1 Scope
This Technical Specification specifies a method for the detection and quantification of Legionella
spp. and L. pneumophila using a quantitative polymerase chain reaction (qPCR). It specifies general
methodological requirements, performance evaluation requirements, and quality control requirements.
Technical details specified in this Technical Specification are given for information only. Any other
technical solutions complying with the performance requirements are suitable.
NOTE For performance requirements, see Clause 10.
This Technical Specification is intended to be applied in the bacteriological investigation of all types of
water (both hot and cold), unless the nature and/or content of suspended matter and/or accompanying
flora interfere with the determination. This interference can result in an adverse effect on both the
detection limit and the quantification limit.
The results are expressed as the number of genome units of Legionella spp. and/or L. pneumophila per
litre of sample.
The method described in this Technical Specification is applicable to all types of water. However,
some additives, e.g. chemicals used for water treatment, can interfere with and/or affect the
sensitivity of the method.
The qPCR methods do not give any information about live or dead cells.
2 Normative references
The following documents, in whole or in part, are normatively referenced in this document and are
indispensable for its application. For dated references, only the edition cited applies. For undated
references, the latest edition of the referenced document (including any amendments) applies.
ISO 19458, Water quality — Sampling for microbiological analysis
3 Terms and definitions
For the purposes of this document, the following terms and definitions apply.
3.1
Legionella
bacterial genus which can be defined by DNA sequences of genes encoding its
specific 16S rRNA
NOTE rRNA is the abbreviation of ribosomal ribonucleic acid.
3.2
Legionella
genus of Gram-negative bacteria normally capable of growth in not less than
2 days on buffered charcoal yeast extract agar containing l-cysteine and iron(III), and forming colonies,
often white, purple to blue or lime green in colour
NOTE Some species fluoresce under long-wavelength UV light. The colonies have a ground-glass appearance
when viewed with a low power stereomicroscope. With a very few exceptions, growth does not occur in the
absence of l-cysteine.
3.3
Legionella pneumophila
species belonging to the Legionella genus which can be defined by its specific
DNA sequences
NOTE The distinction between Legionella spp. and L. pneumophila can be made on the basis of the difference
between the nucleotide sequence in the macrophage infectivity potentiator (mip) gene.
3.4
Legionella pneumophila
species belonging to the Legionella genus giving a positive reaction in the
presence of an anti-L. pneumophila serum
NOTE Within L. pneumophila at least 15 different groups can be distinguished on the basis of serology. The
replication in the environment takes place through intracellular parasitic growth in protozoa.
3.5
deoxyribonucleic acid
DNA
genetic material of living organisms consisting of generic and very specific parts
3.6
polymerase chain reaction
PCR
enzymatic procedure whereby a specific DNA fragment is replicated by a cyclical iterated process of
denaturation, annealing of specific primers and DNA synthesis
3.7
amplification
DNA replication
increase of DNA fragments or amplicons as a result of the PCR reaction
3.8
PCR product
PCR amplicon
DNA that is synthesized by the PCR
3.9
quantitative PCR
qPCR
formation of specific DNA fragments which is highlighted by a labelled fluorescent probe and
monitored in real time
NOTE The intensity of the fluorescence is a measure of the amount of amplicons. By comparison with a
calibration curve, the initial concentration of the DNA target can be determined.
2 © ISO 2012 – All rights reserved

3.10
C value
t
threshold cycle
number of PCR cycles (denaturation and amplification) required to replicate the DNA copies originally
present in the sample, so that the concentration of DNA exceeds the detection limit
NOTE The C value is the intercept of the line that represents the DNA concentration of a sample with the
t
fluorescent base line.
3.11
reverse primer
forward primer
single-strand DNA fragment (oligonucleotide) that serves as a template for specific DNA replication
NOTE The choice of the DNA sequences of both the forward and reverse primers determines which DNA
fragment is replicated. The length of the primer varies from 15 to 30 nucleotides.
3.12
probe
single-stranded DNA fragment, targeting a specific sequence, labelled with a fluorophore that can be
detected in the real-time PCR device
3.13
Taq DNA polymerase
polymerase obtained from the bacterium Thermus aquaticus that lives in hot springs and geysers
NOTE 1 This thermo-stable polymerase is used for the DNA synthesis in the PCR.
NOTE 2 The use of hot-start polymerase is possible to avoid false-positive results.
3.14
Legionella spp. genome unit
GU
unit representing a single copy of the Legionella spp. bacterial genomic DNA
3.15
detection limit of the qPCR
LD
qPCR
lowest number of genome units that give a positive result in the qPCR with 90 % confidence
3.16
quantification limit of the qPCR
LQ
qPCR
lowest number of genome units that can be quantified with an accuracy less than or equal to 0,15log unit
3.17
macrophage infectivity potentiator gene
mip gene
gene present in Legionella spp. which is essential for the infection of the host (protozoa) and
macrophages (humans)
NOTE The unique base sequence of the mip gene of L. pneumophila can be used for the design of the primer
and probe sequences for the specific qPCR detection of L. pneumophila.
3.18
PCR inhibition control
calibrated DNA that is required to be co-amplified with the sample DNA extract using the primers
needed for Legionella spp. or L. pneumophila detection
NOTE 1 The PCR inhibition control should reveal any inhibitor presence in the sample DNA extract.
NOTE 2 The control can be a plasmid, an oligonucleotide or the L. pneumophila genomic DNA. A specific probe
shall be used to detect the inhibition control.
3.19
recovery
efficiency of the DNA extraction
3.20
Legionella pneumophila DNA primary standard
calibrated DNA solution of L. pneumophila (WDCM 00107) with a known quantity of genome units and
an associated uncertainty
NOTE 1 The standard is used to adjust the working calibration DNA solutions.
NOTE 2 For the WDCM catalogue, see Reference [3].
3.21
reference material
ready-to-use calibrated DNA solution connected to the L. pneumophila DNA primary standard (3.20)
NOTE The reference material shall be processed in each PCR run to check the accuracy of the qPCR.
3.22
amplification series
set of PCR amplifications run while using the same PCR reagent batches, same materials, and same
instruments
3.23
working calibration solutions
L. pneumophila (WDCM 00107) DNA calibrated solutions, compared to the L. pneumophila DNA primary
standard, used to establish the calibration curve
NOTE The procedure is specified in 7.4.
4 Principle
The detection and quantification of Legionella spp. by PCR is carried out in three phases:
— concentration of water samples by filtration;
— DNA extraction from the filter;
— amplification, detection and quantification of one or more specific DNA sequences belonging to the
Legionella genus and/or L. pneumophila species by real-time qPCR.
5 Sampling
The samples shall be taken in sterile containers with all the necessary precautions. The sampling
conditions shall be indicated on the test report if they are known. Perform the sampling in accordance
with ISO 19458.
Preferably begin the investigation immediately after the sampling. If samples are delivered to the
laboratory within 24 h after sampling, they can be shipped at room temperature. However, if the delay
between sampling and arrival to the laboratory is longer than 24 h, the shipment shall be performed at
+5 °C ± 3 °C.
Validate the storage of the filter membrane or the sample for a longer time or at another temperature.
For samples from oxidizing biocide-treated water, the sterile container used for collection shall in
addition contain a sufficient quantity of sterile sodium thiosulfate to neutralize the oxidizer (e.g. at a
concentration of 20 mg/l).
4 © ISO 2012 – All rights reserved

Other biocides (bactericides or bacteriostatics) are sometimes used, in particular in cooling tower
circuits. Their presence, which can lead to underestimation, shall thus be declared and indicated on the
test report if it is known. However, it is not always possible to neutralize these products.
6 General testing conditions
6.1 General
PCR is a sensitive detection method. Aerosols, dust, and other particles are carriers of contaminating DNA.
It is therefore essential to separate in space and/or time the different stages of the analysis. In particular,
provide separate dedicated spaces, materials, and equipment for pre- and post-amplification stages.
The principles to be applied are as follows:
— use of disposables compatible with PCR methods is preferred;
— a procedure for eliminating DNA traces shall be implemented in event of accidental contamination
of the premises or apparatus;
— regular quality controls checks shall be used to demonstrate the effectiveness of maintenance
procedures with the objective of ensuring that there is no contaminating legionella DNA (see 11.4).
6.2 Staff
All personnel who perform aspects of the testing procedures shall be trained to work with PCR and
microbiology as appropriate.
The staff shall wear separate laboratory coats for microbiology activities involving cultures and
molecular biology activities. Any gloves used shall be disposable and talc free.
Laboratory coats shall be changed between the areas of low DNA concentration (pre-amplification)
and the areas of high legionella DNA concentration (post-amplification). When laboratory coats are not
disposable, then they shall be periodically cleaned and replaced. Only duly equipped staff shall access
the specific rooms where these tests are run.
6.3 Premises
The laboratory shall contain at least two physically separated areas (e.g. PCR cabinet), the area including
pre-PCR [a) and b) below] and PCR [c) below] activities. Ideally, there should be three physically separated
areas a), b), and c) available:
a) an area for the concentration of samples and DNA extraction;
b) an area for the preparation of PCR reagents (reaction mixtures);
c) an area for amplification.
If automated machines are used, then certain activities can be grouped together in the same area. In all
cases, check that there is no contamination (see 11.4).
Regardless of the amplicon detection and amplification system used, no tube shall be opened after
amplification in areas a), b), and c).
6.4 Apparatus and consumables (excluding reagents)
6.4.1 General
Usual laboratory equipment, and in particular the following.
6.4.1.1 PCR hood.
6.4.1.2 Centrifuge.
6.4.1.3 Water bath.
6.4.1.4 Real-time thermocycler: device used for amplification by PCR which, after each cycle of
polymerization, records a fluorescent signal which is proportional to the amount of amplification product
(genome units).
6.4.1.5 Consumables. All consumable materials used should be free from DNA or if not then
legionella DNA free.
EXAMPLE Filter funnels can be:
— delivered sterile;
— sterilized in an autoclave or oven;
— if made of metal, flamed prior to use.
6.4.2 Concentration
Membrane filters shall be made of polycarbonate or any other compound with a low capacity for
adsorption of protein or DNA, with a nominal porosity of 0,45 µm or less. Do not use a membrane
containing cellulose.
6.4.3 Extraction and PCR (detection and quantification)
6.4.3.1 General. Apart from the concentration phase, it is important to avoid the apparatus coming into
contact with the water sample so as to prevent cross-contamination. Single-use disposables are recommended.
The quality control shall be used to confirm the effectiveness of the decontamination protocols.
Wherever possible, use consumables of “molecular biology” quality.
Careful consideration should be given to the apparatus and consumables specified in 6.4.3.2 to 6.4.3.4.
6.4.3.2 Micropipette: to avoid cross-contamination by aerosols, use tips with hydrophobic filters
and/or positive displacement micropipettes. Use a separate set of micropipettes for each area of activity.
6.4.3.3 Thermoblocs (recommended) to prevent contamination by aerosols.
6.4.3.4 PCR hood, ideally equipped with UV lamps to ensure decontamination of equipment used.
6.5 Reagents
6.5.1 General
All reagents used shall be sterile, free from nucleases and PCR inhibitors; ideally they should be DNA
free or if not then legionella DNA free.
Whenever possible, all reagents shall be dispensed in appropriate volumes so as to avoid reusing the
aliquots. This improves the repeatability of the method. Suitable procedures shall be used to ensure
traceability of all reagents.
Follow suppliers’ recommendations for storage and handling of reagents.
6 © ISO 2012 – All rights reserved

6.5.2 PCR reagents
A PCR reaction mixture generally contains the components indicated in Table 1.
The reaction volumes handled during PCR tests are usually between 1 µl and 100 µl.
To increase PCR repeatability while decreasing the uncertainty associated with small volumes, sufficient
volumes of reaction mixtures shall be prepared to enable at least 10 PCRs to be carried out.
Table 1 — Components used in a typical PCR reaction
a
Component Details
Dilution water Diluent
The composition varies greatly according to the supplier and various additives [bovine
PCR buffer solution serum albumin, dimethyl sulfoxide (DMSO), surface active agents, etc.] appropriate for
the activity or stability of the thermostable DNA polymerase used, can be added
Magnesium in its divalent cationic form is an essential co-factor of DNA polymerase
activity. It forms a complex that is soluble with the dNTP. Its final concentration is thus
MgCl
dependent upon concentrations of dNTP, primers, probe, and target DNA. It shall be
optimized
b
Deoxyribonucleotide triphosphates used in synthesizing DNA by polymerase DNA:
dATP: 2’-deoxyadenosine 5’-triphosphate;
dNTP dTTP: 2’-deoxythymidine 5’-triphosphate;
dCTP: 2’-deoxycytidine 5’-triphosphate;
dGTP: 2’-deoxyguanosine 5’-triphosphate
Oligonucleotides of determined size and sequence that determine the specific sequence
Primers
to be amplified by PCR
Thermostable DNA Enzyme or mix of enzymes used for in-vitro DNA polymerase reaction.
polymerase NOTE Use of hot-start Taq DNA polymerase is possible to avoid false-positive results.
Oligonucleotides of determined size and sequence that hybridize on to a specific por-
Probes tion of the amplicon and which bear a fluorophore enabling the recognition of the
fragment
a
Depending on their source, some of these components may previously be mixed in the PCR buffer solution (ready-to-use
PCR master mix products including the components, except primers and probe are available).
b
A dTTP + dUTP (2’-deoxyuridine 5’-triphosphate) mix and a uracil-DNA N-glycosylase (UNG) enzyme can be used. This
system is not mandatory for methods using a real-time detection system not requiring opening of tubes after amplification.
Any equivalent system able to specifically destroy the amplicons from previous PCR, in the reaction mix, can be used.
6.5.3 Other reagents
6.5.3.1 DNA co-precipitants, used to improve precipitation yield during DNA extraction, shall contain
no nuclease activity or sequence homologous to the target sequences of the PCR tests.
6.5.3.2 TE buffer, pH 8,0.
Tris(hydroxymethyl)aminomethane (C H NO ) tris 10 mmol/l
4 11 3
Ethylenediaminetetraacetic acid (C H N ) EDTA 1 mmol/l
10 16 2
DNAse- and RNAse-free water
Dissolve the tris and EDTA in DNAse- and RNAse-free water and adjust with HCl to pH 8,0. For a 10-fold
diluted TE buffer, dilute the solution with DNAse- and RNAse-free water.
6.6 Decontamination of equipment and premises
After accidental or non-accidental contamination, any recyclable equipment or material shall be treated
by immersing in or soaking with, for example, a solution of bleach with 1,7 % volume fraction active
chlorine or 1 % volume fraction hydrochloric acid or detergent.
Ultraviolet radiation can also be used to decontaminate small equipment or materials, counter tops or
even an entire room in addition to decontamination solutions.
6.7 Treatment and elimination of waste
Toxic and infectious waste shall be stored, used, and eliminated according to local regulations.
It is recommended that consumables contaminated by amplification products be discarded within a day
of their use.
7 Procedure
7.1 Concentration
Filter as large a volume of the sample as practicable (usually 1 l) to concentrate the bacteria. Record
the volume (V) of sample filtered. This is required to calculate the results (see Clause 8). The limit of
detection, LD (see 10.5) and limit of quantification, LQ (see 10.4.4), are adversely affected by
meth meth
small sample volumes and increase proportionally.
7.2 DNA extraction
7.2.1 General
Extraction involves freeing the DNA by lysing the microorganisms, then (or at the same time) purifying
the DNA while eliminating the other components as much as possible, particularly the PCR inhibitors.
7.2.2 Protocols
The DNA is directly extracted on the filter. It is recommended that the whole concentrate be treated.
To extract the DNA, several suitable methods can be used such as physical (e.g. cycles of freezing and
thawing), chemical (e.g. guanidine thiocyanate buffer) or biological (e.g. enzyme digestion).
Purification can take place after or during DNA extraction. This purification can be performed, for
example, using chloroform and/or by fractional precipitation, with solvents such as ethanol, isopropanol,
and/or adsorption on solid matrices (e.g. resin, silica, glass, membrane, magnetic beads).
The purified DNA shall be put back into suspension in a solution that guarantees the stability of the DNA
and the quality of the PCR, e.g. a buffer containing a magnesium-chelating agent (EDTA) or proteins
(bovine serum albumin).
PCR quantification of Legionella spp. and L. pneumophila genome units shall be performed with the
same DNA extract.
7.2.3 Stability of DNA extracts
DNA extracts shall be stored at 5 °C ± 3 °C and analysed within 24 h of preparation. Any longer storage
at this temperature requires validation.
DNA extracts can be frozen below –18 °C for several months; these storage conditions shall be validated.
8 © ISO 2012 – All rights reserved

7.3 DNA amplification by PCR
7.3.1 General
This involves amplification of a limited target sequence in the 5’-to-3’ direction on each of the DNA
strands by two additional primers.
During the development of the PCR test, the amplification parameters (number of cycles, hybridization
temperature) and the reaction mix composition (dNTP, magnesium, primers, and buffer) will have been
defined and optimized. Once these parameters have been established, the performance of the method
shall be evaluated (see Clause 10).
The PCR amplification shall include controls described in Clause 11 (negative and positive controls, PCR
inhibition control, and reference material).
7.3.2 Target sequences, primers and probes
7.3.2.1 General. One or more sequences can be amplified to detect and differentiate the DNA from
bacteria belonging to Legionella spp. and L. pneumophila.
The specificity of the primers and probes shall be checked:
a) theoretically by homology research using appropriate software in the main databases such as NCBI
Genbank (Reference [1]) or EMBL Nucleotide sequence database (Reference [2]);
b) by testing on strains of legionella, L. pneumophila and strains of microorganisms likely to be found
in the same ecological niches as legionella.
Regarding b), a list of the minimum number of strains to be tested is given in 10.2. For strains not
belonging to the genus Legionella, no amplification product shall be detected by the real-time PCR. The
specificity of the probes and primers shall be evaluated on each new strain of legionella described as a
pathogen for humans (described and referenced at the WDCM).
For L. pneumophila the sequences described below are compatible with the list of strains to be tested
for specificity. Other sequences may be used as long as they match the exclusivity and inclusivity
requirements (see the list in 10.2).
There follow examples of primers (7.3.2.2 and 7.3.2.3) and probes (7.3.2.4) designed to amplify and
quantify the L. pneumophila specific fragment of mip (7.3.2.5).
These preparations are given as examples and shall be validated according to Clause 10.
7.3.2.2 Forward primer L. pneumophila: LpneuF, with the following composition.
Sequence 5’-CCGATGCCACATCATTAGC-3’
TE buffer (6.5.3.2) diluted 10 times.
LpneuF is prepared as follows. Prepare a stock solution of primers in 10 times diluted TE buffer at a
final concentration of 100 μmol/l. Store this stock solution below –18 °C. Dilute the stock solution to a
working solution of 10 μmol/l. For the preparation of both the stock solution and the working solution,
use a 10 times diluted TE buffer. Store this working solution for up to six months below –18 °C.
7.3.2.3 Reverse primer L. pneumophila: LpneuR, with the following composition.
Sequence 5’-CCAATTGAGCGCCACTCATAG-3’
TE buffer (6.5.3.2) diluted 10 times.
LpneuR is prepared as in a similar fashion to LpneuF (7.3.2.2).
7.3.2.4 Probe L. pneumophila: LpneuP, with the following composition.
Sequence 5’-TGCCTTTAGCCATTGCTTCCG-3’
Label 5’: Fluorophore (carboxyfluorescein, FAM)
Label 3’: Quencher (black hole quencher 1, BHQ1)
TE buffer (6.5.3.2)
LpneuP is prepared as follows. Resuspend the freeze-dried probe in the 10-fold diluted TE buffer to a
final concentration of 100 μmol/l. Store the stock solution below –18 °C. Dilute the stock solution with
TE-buffer (6.5.3.2) diluted 10 times to make a working solution of 10 μmol/l. Store the working solution
for up to six months below –18 °C.
7.3.2.5 DNA sequence of mip fragment of L. pneumophila.
5’-CCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGA
AGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTA
TGAGTGGCGCTCAATTGG-3’
7.3.3 Amplification mix preparation
Ideally, prepare the reaction mixtures immediately before use. If the reaction mix is stored, then its
stability requires validation by performing a verification of the linearity of the calibration function after
storage (see 10.3). This validation shall meet the criteria defined in 10.3.4.
The reaction mix and the extracted DNA shall be mixed just before amplification. To prevent the
consequences of accidental contamination, PCR amplifications can be performed from dUTP to activate
a UNG (uracil-DNA N-glycosylase) which removes all traces of amplicon before any new amplification.
The composition of a qPCR mix is given in Table 2. This composition is given as an example and shall be
validated according to Clause 10.
Mix the components in the proportion indicated in Table 2. Prepare the PCR mix just before use.
7.4 Quantitative detection
7.4.1 General
This detection shall enable detection and quantification of specific amplicons for Legionella spp. and/or
L. pneumophila.
The specificity of the quantitative PCR shall be guaranteed by using specific hybridization probe(s).
To ensure the quality of the quantitative detection, it is necessary to use a) and b).
a) An external DNA standard range, i.e. L. pneumophila-calibrated DNA solutions, derived from the
primary standard (see 11.2).
b) A PCR inhibition control, such as a calibrated solution of plasmid or oligonucleotide or L. pneumophila
genome unit, co-amplified with the DNA from the sample. This approach shall be used to reveal any
inhibitor presence in the sample DNA extract (see 11.6).
It is necessary to amplify the external calibrated standards and the inhibition control using the same
primers used to amplify the target sequences of the sample.
10 © ISO 2012 – All rights reserved

In approaches a) and b), quantification is performed by interpolation within the linear response range
of the DNA quantification method. This concentration range shall be determined beforehand (10.3).
The extracted DNA can, if necessary, be diluted to obtain a concentration situated within this linear
response area.
The amplification shall be performed with a real-time PCR thermocycler with a sufficient number of
cycles. This number of cycles shall not be less than the estimated value of the ordinate intercept (refer
to 10.3) increased by 5.
IMPORTANT — It is recommended, whenever possible, to carry out several tests using the same
DNA extract. Repeating tests and obtaining a mean result improves accuracy.
Table 2 — Composition of the qPCR mix
Volume per sample
Reagents Final concentration
μl
BSA for PCR applications 5 0,4 μg/μl
a
Taq polymerase (3.13) 1 0,1 U/μl
PCR buffer (Table 1) 5 1×
dNTPs (Table 1) 1 400 nmol/l
a
MgCl (Table 1) 3 According to the Taq DNA polymer-
ase requirements
Primer LpneuF (7.3.2.2) 1 200 nmol/l
Primer LpneuR (7.3.2.3) 1 200 nmol/l
Probe LpneuP (7.3.2.4) 1 200 nmol/l
Water for PCR applications make up to 40
PCR inhibition control shall be added according to 10.6.
a
The volume required depends on the concentration in the stock solutions and can vary with supplier.
7.4.2 Protocol
7.4.2.1 Introduction
The thermocycler programme in Table 3 is indicated as an example for the detection of L. pneumophila
by using the primers and probe sequences specified in 7.3.2.
This programme shall be adapted according to the model and the type of the thermocycler and shall be
validated according to the requirements stated in Clause 10.
Table 3 — Temperature and time programme of PCR
Denaturing of DNA and activation of hot-start Taq polymerase 3 min at 95 °C
20 s at 95 °C
DNA replication
60 s at 60 °C
Number of cycles 43
The programme shall be set in such a way that, during the DNA replication, the fluorescence signals of
the L. pneumophila specific probe and the PCR internal control specific probe are measured.
NOTE The duration of the hot-start step depends on the Taq DNA polymerase used and is stated on the
product specification from the manufacturer.
7.4.2.2 General
The following approach can be used for detection or quantification of amplicons.
Monitoring of the PCR is based on the measurement of a fluorescent signal due to hybridization of at
least one fluorescent labelled probe internal to the amplicon.
A working calibration range (external) comprising at least four levels (for example, solutions at 25 GU,
250 GU, 2 500 GU, and 25 000 GU of L. pneumophila per reaction tube) is prepared using the working
calibration solution (commercial solution or solution prepared according to Annex A). The first point of
the DNA range shall be equal to the quantification limit LQ .
qPCR
The working calibration solution shall be connected to the legionella DNA primary standard (see 11.2).
An expiration date for this solution shall be set for the planned storage conditions and verified by
coupling to the primary standard.
At least once during each sample amplification series (same PCR reagent batches, same materials), this
working calibration range shall be analysed under the same conditions as that used for the samples.
The stability of the calibration within a series and/or the reuse of a diluted range shall be verified by
measuring the reference material upon each use of the thermocycler (see 11.3).
7.4.2.3 Real-time quantification
Aside from the fact that real-time thermocyclers can detect amplification products on site, they are
also particularly appropriate for quantitative PCR. The detection systems enable the limits associated
with the plateau effect to be circumvented by directly measuring the quantity of amplicon synthesized
during the exponential amplification phase. These processes involve extremely sensitive fluorescent
emission quantification and detection systems. The principle currently used for calibration is based on
quantification of specific amplicons using at least one internal fluorescent labelled probe. Quantification
is based on the determination the cycle threshold, C , proportional to the decimal logarithm of the
t
number of genome units initially present in the reaction mix.
A method for determining the C is given as an example in Annex B.
t
Other mathematical methods for determining C can be used. In this case, the method used shall be
t
described and its effect in terms of measurement precision shall be checked by compliance with the
standard curve evaluation protocol (see 10.3).
8 Expression of the results
Express the results according to Table 4 in number of genome units (GU) of Legionella spp. and/or
L. pneumophila per litre of sample (taking into account the filtered volume of water sample) to two
significant figures.
EXAMPLE 1 12 312 GU/l of Legionella spp. is expressed as “12 000 GU/l of Legionella spp.”
EXAMPLE 2 723 GU/l of L. pneumophila is expressed as “720 GU/l of L. pneumophila”.
9 Test report
This test report shall contain at least the following information:
a) the test method used, together with a reference to this Technical Specification (ISO/TS 12869:2012);
b) all the information required to identify and describe the sample;
c) sam
...

SLOVENSKI STANDARD
01-september-2013
Kakovost vode - Ugotavljanje prisotnosti in števila Legionella spp. in/ali Legionella
pneumophila s koncentriranjem in pomnoževanjem genov s kvantitativno verižno
reakcijo s polimerazo (qPCR)
Water quality - Detection and quantification of Legionella spp. and/or Legionella
pneumophila by concentration and genic amplification by quantitative polymerase chain
reaction (qPCR)
Qualité de l'eau - Détection et quantification de Legionella spp. et/ou Legionella
pneumophila par concentration et amplification génique par réaction de polymérisation
en chaîne quantitative (qPCR)
Ta slovenski standard je istoveten z: ISO/TS 12869:2012
ICS:
07.100.20 Mikrobiologija vode Microbiology of water
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

TECHNICAL ISO/TS
SPECIFICATION 12869
First edition
2012-11-01
Water quality — Detection and
quantification of Legionella spp.
and/or Legionella pneumophila by
concentration and genic amplification
by quantitative polymerase chain
reaction (qPCR)
Qualité de l’eau — Détection et quantification de Legionellaa spp. et/ou
Legionellaa pneumophilaa par concentration et amplification génique
par réaction de polymérisation en chaîne quantitative (qPCR)
Reference number
©
ISO 2012
© ISO 2012
All rights reserved. Unless otherwise specified, no part of this publication may be reproduced or utilized in any form or by any
means, electronic or mechanical, including photocopying and microfilm, without permission in writing from either ISO at the
address below or ISO’s member body in the country of the requester.
ISO copyright office
Case postale 56 • CH-1211 Geneva 20
Tel. + 41 22 749 01 11
Fax + 41 22 749 09 47
E-mail [e-mail]
Web www.iso.org
Published in Switzerland
ii © ISO 2012 – All rights reserved

Contents Page
Foreword .iv
Introduction .v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 Principle . 4
5 Sampling . 4
6 General testing conditions . 5
6.1 General . 5
6.2 Staff . 5
6.3 Premises . 5
6.4 Apparatus and consumables (excluding reagents) . 5
6.5 Reagents. 6
6.6 Decontamination of equipment and premises . 8
6.7 Treatment and elimination of waste . 8
7 Procedure. 8
7.1 Concentration. 8
7.2 DNA extraction . 8
7.3 DNA amplification by PCR . 9
7.4 Quantitative detection .10
8 Expression of the results .12
9 Test report .12
10 Technical protocol for the characterization and the validation of the method .13
10.1 General .13
10.2 Inclusivity and exclusivity of probes and primers .14
10.3 Verification of the calibration function of the quantitative PCR phase .14
10.4 Verification of the PCR limit of quantification, LQ .
qPCR 19
10.5 Verification of the PCR limit of detection (LDqPCR) .21
10.6 Recovery method .21
10.7 Robustness .22
10.8 Measurement uncertainty of the whole method .23
11 Quality controls .23
11.1 General .23
11.2 Connecting the calibration solution and the reference material to the primary standard 24
11.3 Monitoring of the performances .26
11.4 Positive and negative controls of the method .26
11.5 PCR reagent blank .26
11.6 Inhibition control .26
Annex A (informative) Example of protocol for producing a quantitative standard DNA solution .29
Annex B (informative) Example of method for determining the cycle threshold .30
Annex C (informative) Example of a study of the quantitative PCR phase calibration function .32
Annex D (informative) Specific Student distribution .35
Annex E (informative) Example of recovery evaluation .36
Annex F (informative) Example of overall uncertainty evaluation .37
Annex G (normative) Evaluation of the performances of a third party validated method .38
Bibliography .39
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out
through ISO technical committees. Each member body interested in a subject for which a technical
committee has been established has the right to be represented on that committee. International
organizations, governmental and non-governmental, in liaison with ISO, also take part in the work.
ISO collaborates closely with the International Electrotechnical Commission (IEC) on all matters of
electrotechnical standardization.
International Standards are drafted in accordance with the rules given in the ISO/IEC Directives, Part 2.
The main task of technical committees is to prepare International Standards. Draft International
Standards adopted by the technical committees are circulated to the member bodies for voting.
Publication as an International Standard requires approval by at least 75 % of the member bodies
casting a vote.
In other circumstances, particularly when there is an urgent market requirement for such documents, a
technical committee may decide to publish other types of document:
— an ISO Publicly Available Specification (ISO/PAS) represents an agreement between technical
experts in an ISO working group and is accepted for publication if it is approved by more than 50 %
of the members of the parent committee casting a vote;
— an ISO Technical Specification (ISO/TS) represents an agreement between the members of a
technical committee and is accepted for publication if it is approved by 2/3 of the members of the
committee casting a vote.
An ISO/PAS or ISO/TS is reviewed after three years in order to decide whether it will be confirmed for
a further three years, revised to become an International Standard, or withdrawn. If the ISO/PAS or
ISO/TS is confirmed, it is reviewed again after a further three years, at which time it must either be
transformed into an International Standard or be withdrawn.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. ISO shall not be held responsible for identifying any or all such patent rights.
ISO/TS 12869 was prepared by Technical Committee ISO/TC 147, Water quality, Subcommittee SC 4,
Microbiological methods.
iv © ISO 2012 – All rights reserved

Introduction
This Technical Specification specifies a method for the detection and quantification of Legionella species
(spp.) and Legionella pneumophila (L. pneumophila) in water using a quantitative polymerase chain
reaction (qPCR).
The presence of L. pneumophila or Legionella spp. in water samples is demonstrated and quantified by
amplifying DNA sequences (PCR) with specific oligonucleotides. Specificity of the detection is ensured
by using a target sequence specific fluorescent-labelled probe. The increase in the amount of the DNA
amplicon can be measured and visualized in real time by a quantitative PCR device with fluorophore
specific filters.
A calibration curve is used for quantification purposes. The guidelines, minimum requirements and
performance characteristics are intended to guarantee that the results are reliable and reproducible
between different laboratories.
This Technical Specification specifies a determination of the recovery of the DNA extraction. The
performance of the extraction procedure is not fully covered (lysis efficiency is not estimated).
TECHNICAL SPECIFICATION ISO/TS 12869:2012(E)
Water quality — Detection and quantification of Legionella
spp. and/or Legionella pneumophila by concentration
and genic amplification by quantitative polymerase chain
reaction (qPCR)
WARNING — Legionella spp. can be handled safely by experienced microbiologists on the open
bench in a conventional microbiology laboratory conforming to containment level 2. Infection
is caused by inhalation of the organism; hence it is advisable to assess all techniques for their
ability to produce aerosols. If in doubt, carry out the work in a safety cabinet.
1 Scope
This Technical Specification specifies a method for the detection and quantification of Legionella
spp. and L. pneumophila using a quantitative polymerase chain reaction (qPCR). It specifies general
methodological requirements, performance evaluation requirements, and quality control requirements.
Technical details specified in this Technical Specification are given for information only. Any other
technical solutions complying with the performance requirements are suitable.
NOTE For performance requirements, see Clause 10.
This Technical Specification is intended to be applied in the bacteriological investigation of all types of
water (both hot and cold), unless the nature and/or content of suspended matter and/or accompanying
flora interfere with the determination. This interference can result in an adverse effect on both the
detection limit and the quantification limit.
The results are expressed as the number of genome units of Legionella spp. and/or L. pneumophila per
litre of sample.
The method described in this Technical Specification is applicable to all types of water. However,
some additives, e.g. chemicals used for water treatment, can interfere with and/or affect the
sensitivity of the method.
The qPCR methods do not give any information about live or dead cells.
2 Normative references
The following documents, in whole or in part, are normatively referenced in this document and are
indispensable for its application. For dated references, only the edition cited applies. For undated
references, the latest edition of the referenced document (including any amendments) applies.
ISO 19458, Water quality — Sampling for microbiological analysis
3 Terms and definitions
For the purposes of this document, the following terms and definitions apply.
3.1
Legionella
bacterial genus which can be defined by DNA sequences of genes encoding its
specific 16S rRNA
NOTE rRNA is the abbreviation of ribosomal ribonucleic acid.
3.2
Legionella
genus of Gram-negative bacteria normally capable of growth in not less than
2 days on buffered charcoal yeast extract agar containing l-cysteine and iron(III), and forming colonies,
often white, purple to blue or lime green in colour
NOTE Some species fluoresce under long-wavelength UV light. The colonies have a ground-glass appearance
when viewed with a low power stereomicroscope. With a very few exceptions, growth does not occur in the
absence of l-cysteine.
3.3
Legionella pneumophila
species belonging to the Legionella genus which can be defined by its specific
DNA sequences
NOTE The distinction between Legionella spp. and L. pneumophila can be made on the basis of the difference
between the nucleotide sequence in the macrophage infectivity potentiator (mip) gene.
3.4
Legionella pneumophila
species belonging to the Legionella genus giving a positive reaction in the
presence of an anti-L. pneumophila serum
NOTE Within L. pneumophila at least 15 different groups can be distinguished on the basis of serology. The
replication in the environment takes place through intracellular parasitic growth in protozoa.
3.5
deoxyribonucleic acid
DNA
genetic material of living organisms consisting of generic and very specific parts
3.6
polymerase chain reaction
PCR
enzymatic procedure whereby a specific DNA fragment is replicated by a cyclical iterated process of
denaturation, annealing of specific primers and DNA synthesis
3.7
amplification
DNA replication
increase of DNA fragments or amplicons as a result of the PCR reaction
3.8
PCR product
PCR amplicon
DNA that is synthesized by the PCR
3.9
quantitative PCR
qPCR
formation of specific DNA fragments which is highlighted by a labelled fluorescent probe and
monitored in real time
NOTE The intensity of the fluorescence is a measure of the amount of amplicons. By comparison with a
calibration curve, the initial concentration of the DNA target can be determined.
2 © ISO 2012 – All rights reserved

3.10
C value
t
threshold cycle
number of PCR cycles (denaturation and amplification) required to replicate the DNA copies originally
present in the sample, so that the concentration of DNA exceeds the detection limit
NOTE The C value is the intercept of the line that represents the DNA concentration of a sample with the
t
fluorescent base line.
3.11
reverse primer
forward primer
single-strand DNA fragment (oligonucleotide) that serves as a template for specific DNA replication
NOTE The choice of the DNA sequences of both the forward and reverse primers determines which DNA
fragment is replicated. The length of the primer varies from 15 to 30 nucleotides.
3.12
probe
single-stranded DNA fragment, targeting a specific sequence, labelled with a fluorophore that can be
detected in the real-time PCR device
3.13
Taq DNA polymerase
polymerase obtained from the bacterium Thermus aquaticus that lives in hot springs and geysers
NOTE 1 This thermo-stable polymerase is used for the DNA synthesis in the PCR.
NOTE 2 The use of hot-start polymerase is possible to avoid false-positive results.
3.14
Legionella spp. genome unit
GU
unit representing a single copy of the Legionella spp. bacterial genomic DNA
3.15
detection limit of the qPCR
LD
qPCR
lowest number of genome units that give a positive result in the qPCR with 90 % confidence
3.16
quantification limit of the qPCR
LQ
qPCR
lowest number of genome units that can be quantified with an accuracy less than or equal to 0,15log unit
3.17
macrophage infectivity potentiator gene
mip gene
gene present in Legionella spp. which is essential for the infection of the host (protozoa) and
macrophages (humans)
NOTE The unique base sequence of the mip gene of L. pneumophila can be used for the design of the primer
and probe sequences for the specific qPCR detection of L. pneumophila.
3.18
PCR inhibition control
calibrated DNA that is required to be co-amplified with the sample DNA extract using the primers
needed for Legionella spp. or L. pneumophila detection
NOTE 1 The PCR inhibition control should reveal any inhibitor presence in the sample DNA extract.
NOTE 2 The control can be a plasmid, an oligonucleotide or the L. pneumophila genomic DNA. A specific probe
shall be used to detect the inhibition control.
3.19
recovery
efficiency of the DNA extraction
3.20
Legionella pneumophila DNA primary standard
calibrated DNA solution of L. pneumophila (WDCM 00107) with a known quantity of genome units and
an associated uncertainty
NOTE 1 The standard is used to adjust the working calibration DNA solutions.
NOTE 2 For the WDCM catalogue, see Reference [3].
3.21
reference material
ready-to-use calibrated DNA solution connected to the L. pneumophila DNA primary standard (3.20)
NOTE The reference material shall be processed in each PCR run to check the accuracy of the qPCR.
3.22
amplification series
set of PCR amplifications run while using the same PCR reagent batches, same materials, and same
instruments
3.23
working calibration solutions
L. pneumophila (WDCM 00107) DNA calibrated solutions, compared to the L. pneumophila DNA primary
standard, used to establish the calibration curve
NOTE The procedure is specified in 7.4.
4 Principle
The detection and quantification of Legionella spp. by PCR is carried out in three phases:
— concentration of water samples by filtration;
— DNA extraction from the filter;
— amplification, detection and quantification of one or more specific DNA sequences belonging to the
Legionella genus and/or L. pneumophila species by real-time qPCR.
5 Sampling
The samples shall be taken in sterile containers with all the necessary precautions. The sampling
conditions shall be indicated on the test report if they are known. Perform the sampling in accordance
with ISO 19458.
Preferably begin the investigation immediately after the sampling. If samples are delivered to the
laboratory within 24 h after sampling, they can be shipped at room temperature. However, if the delay
between sampling and arrival to the laboratory is longer than 24 h, the shipment shall be performed at
+5 °C ± 3 °C.
Validate the storage of the filter membrane or the sample for a longer time or at another temperature.
For samples from oxidizing biocide-treated water, the sterile container used for collection shall in
addition contain a sufficient quantity of sterile sodium thiosulfate to neutralize the oxidizer (e.g. at a
concentration of 20 mg/l).
4 © ISO 2012 – All rights reserved

Other biocides (bactericides or bacteriostatics) are sometimes used, in particular in cooling tower
circuits. Their presence, which can lead to underestimation, shall thus be declared and indicated on the
test report if it is known. However, it is not always possible to neutralize these products.
6 General testing conditions
6.1 General
PCR is a sensitive detection method. Aerosols, dust, and other particles are carriers of contaminating DNA.
It is therefore essential to separate in space and/or time the different stages of the analysis. In particular,
provide separate dedicated spaces, materials, and equipment for pre- and post-amplification stages.
The principles to be applied are as follows:
— use of disposables compatible with PCR methods is preferred;
— a procedure for eliminating DNA traces shall be implemented in event of accidental contamination
of the premises or apparatus;
— regular quality controls checks shall be used to demonstrate the effectiveness of maintenance
procedures with the objective of ensuring that there is no contaminating legionella DNA (see 11.4).
6.2 Staff
All personnel who perform aspects of the testing procedures shall be trained to work with PCR and
microbiology as appropriate.
The staff shall wear separate laboratory coats for microbiology activities involving cultures and
molecular biology activities. Any gloves used shall be disposable and talc free.
Laboratory coats shall be changed between the areas of low DNA concentration (pre-amplification)
and the areas of high legionella DNA concentration (post-amplification). When laboratory coats are not
disposable, then they shall be periodically cleaned and replaced. Only duly equipped staff shall access
the specific rooms where these tests are run.
6.3 Premises
The laboratory shall contain at least two physically separated areas (e.g. PCR cabinet), the area including
pre-PCR [a) and b) below] and PCR [c) below] activities. Ideally, there should be three physically separated
areas a), b), and c) available:
a) an area for the concentration of samples and DNA extraction;
b) an area for the preparation of PCR reagents (reaction mixtures);
c) an area for amplification.
If automated machines are used, then certain activities can be grouped together in the same area. In all
cases, check that there is no contamination (see 11.4).
Regardless of the amplicon detection and amplification system used, no tube shall be opened after
amplification in areas a), b), and c).
6.4 Apparatus and consumables (excluding reagents)
6.4.1 General
Usual laboratory equipment, and in particular the following.
6.4.1.1 PCR hood.
6.4.1.2 Centrifuge.
6.4.1.3 Water bath.
6.4.1.4 Real-time thermocycler: device used for amplification by PCR which, after each cycle of
polymerization, records a fluorescent signal which is proportional to the amount of amplification product
(genome units).
6.4.1.5 Consumables. All consumable materials used should be free from DNA or if not then
legionella DNA free.
EXAMPLE Filter funnels can be:
— delivered sterile;
— sterilized in an autoclave or oven;
— if made of metal, flamed prior to use.
6.4.2 Concentration
Membrane filters shall be made of polycarbonate or any other compound with a low capacity for
adsorption of protein or DNA, with a nominal porosity of 0,45 µm or less. Do not use a membrane
containing cellulose.
6.4.3 Extraction and PCR (detection and quantification)
6.4.3.1 General. Apart from the concentration phase, it is important to avoid the apparatus coming into
contact with the water sample so as to prevent cross-contamination. Single-use disposables are recommended.
The quality control shall be used to confirm the effectiveness of the decontamination protocols.
Wherever possible, use consumables of “molecular biology” quality.
Careful consideration should be given to the apparatus and consumables specified in 6.4.3.2 to 6.4.3.4.
6.4.3.2 Micropipette: to avoid cross-contamination by aerosols, use tips with hydrophobic filters
and/or positive displacement micropipettes. Use a separate set of micropipettes for each area of activity.
6.4.3.3 Thermoblocs (recommended) to prevent contamination by aerosols.
6.4.3.4 PCR hood, ideally equipped with UV lamps to ensure decontamination of equipment used.
6.5 Reagents
6.5.1 General
All reagents used shall be sterile, free from nucleases and PCR inhibitors; ideally they should be DNA
free or if not then legionella DNA free.
Whenever possible, all reagents shall be dispensed in appropriate volumes so as to avoid reusing the
aliquots. This improves the repeatability of the method. Suitable procedures shall be used to ensure
traceability of all reagents.
Follow suppliers’ recommendations for storage and handling of reagents.
6 © ISO 2012 – All rights reserved

6.5.2 PCR reagents
A PCR reaction mixture generally contains the components indicated in Table 1.
The reaction volumes handled during PCR tests are usually between 1 µl and 100 µl.
To increase PCR repeatability while decreasing the uncertainty associated with small volumes, sufficient
volumes of reaction mixtures shall be prepared to enable at least 10 PCRs to be carried out.
Table 1 — Components used in a typical PCR reaction
a
Component Details
Dilution water Diluent
The composition varies greatly according to the supplier and various additives [bovine
PCR buffer solution serum albumin, dimethyl sulfoxide (DMSO), surface active agents, etc.] appropriate for
the activity or stability of the thermostable DNA polymerase used, can be added
Magnesium in its divalent cationic form is an essential co-factor of DNA polymerase
activity. It forms a complex that is soluble with the dNTP. Its final concentration is thus
MgCl
dependent upon concentrations of dNTP, primers, probe, and target DNA. It shall be
optimized
b
Deoxyribonucleotide triphosphates used in synthesizing DNA by polymerase DNA:
dATP: 2’-deoxyadenosine 5’-triphosphate;
dNTP dTTP: 2’-deoxythymidine 5’-triphosphate;
dCTP: 2’-deoxycytidine 5’-triphosphate;
dGTP: 2’-deoxyguanosine 5’-triphosphate
Oligonucleotides of determined size and sequence that determine the specific sequence
Primers
to be amplified by PCR
Thermostable DNA Enzyme or mix of enzymes used for in-vitro DNA polymerase reaction.
polymerase NOTE Use of hot-start Taq DNA polymerase is possible to avoid false-positive results.
Oligonucleotides of determined size and sequence that hybridize on to a specific por-
Probes tion of the amplicon and which bear a fluorophore enabling the recognition of the
fragment
a
Depending on their source, some of these components may previously be mixed in the PCR buffer solution (ready-to-use
PCR master mix products including the components, except primers and probe are available).
b
A dTTP + dUTP (2’-deoxyuridine 5’-triphosphate) mix and a uracil-DNA N-glycosylase (UNG) enzyme can be used. This
system is not mandatory for methods using a real-time detection system not requiring opening of tubes after amplification.
Any equivalent system able to specifically destroy the amplicons from previous PCR, in the reaction mix, can be used.
6.5.3 Other reagents
6.5.3.1 DNA co-precipitants, used to improve precipitation yield during DNA extraction, shall contain
no nuclease activity or sequence homologous to the target sequences of the PCR tests.
6.5.3.2 TE buffer, pH 8,0.
Tris(hydroxymethyl)aminomethane (C H NO ) tris 10 mmol/l
4 11 3
Ethylenediaminetetraacetic acid (C H N ) EDTA 1 mmol/l
10 16 2
DNAse- and RNAse-free water
Dissolve the tris and EDTA in DNAse- and RNAse-free water and adjust with HCl to pH 8,0. For a 10-fold
diluted TE buffer, dilute the solution with DNAse- and RNAse-free water.
6.6 Decontamination of equipment and premises
After accidental or non-accidental contamination, any recyclable equipment or material shall be treated
by immersing in or soaking with, for example, a solution of bleach with 1,7 % volume fraction active
chlorine or 1 % volume fraction hydrochloric acid or detergent.
Ultraviolet radiation can also be used to decontaminate small equipment or materials, counter tops or
even an entire room in addition to decontamination solutions.
6.7 Treatment and elimination of waste
Toxic and infectious waste shall be stored, used, and eliminated according to local regulations.
It is recommended that consumables contaminated by amplification products be discarded within a day
of their use.
7 Procedure
7.1 Concentration
Filter as large a volume of the sample as practicable (usually 1 l) to concentrate the bacteria. Record
the volume (V) of sample filtered. This is required to calculate the results (see Clause 8). The limit of
detection, LD (see 10.5) and limit of quantification, LQ (see 10.4.4), are adversely affected by
meth meth
small sample volumes and increase proportionally.
7.2 DNA extraction
7.2.1 General
Extraction involves freeing the DNA by lysing the microorganisms, then (or at the same time) purifying
the DNA while eliminating the other components as much as possible, particularly the PCR inhibitors.
7.2.2 Protocols
The DNA is directly extracted on the filter. It is recommended that the whole concentrate be treated.
To extract the DNA, several suitable methods can be used such as physical (e.g. cycles of freezing and
thawing), chemical (e.g. guanidine thiocyanate buffer) or biological (e.g. enzyme digestion).
Purification can take place after or during DNA extraction. This purification can be performed, for
example, using chloroform and/or by fractional precipitation, with solvents such as ethanol, isopropanol,
and/or adsorption on solid matrices (e.g. resin, silica, glass, membrane, magnetic beads).
The purified DNA shall be put back into suspension in a solution that guarantees the stability of the DNA
and the quality of the PCR, e.g. a buffer containing a magnesium-chelating agent (EDTA) or proteins
(bovine serum albumin).
PCR quantification of Legionella spp. and L. pneumophila genome units shall be performed with the
same DNA extract.
7.2.3 Stability of DNA extracts
DNA extracts shall be stored at 5 °C ± 3 °C and analysed within 24 h of preparation. Any longer storage
at this temperature requires validation.
DNA extracts can be frozen below –18 °C for several months; these storage conditions shall be validated.
8 © ISO 2012 – All rights reserved

7.3 DNA amplification by PCR
7.3.1 General
This involves amplification of a limited target sequence in the 5’-to-3’ direction on each of the DNA
strands by two additional primers.
During the development of the PCR test, the amplification parameters (number of cycles, hybridization
temperature) and the reaction mix composition (dNTP, magnesium, primers, and buffer) will have been
defined and optimized. Once these parameters have been established, the performance of the method
shall be evaluated (see Clause 10).
The PCR amplification shall include controls described in Clause 11 (negative and positive controls, PCR
inhibition control, and reference material).
7.3.2 Target sequences, primers and probes
7.3.2.1 General. One or more sequences can be amplified to detect and differentiate the DNA from
bacteria belonging to Legionella spp. and L. pneumophila.
The specificity of the primers and probes shall be checked:
a) theoretically by homology research using appropriate software in the main databases such as NCBI
Genbank (Reference [1]) or EMBL Nucleotide sequence database (Reference [2]);
b) by testing on strains of legionella, L. pneumophila and strains of microorganisms likely to be found
in the same ecological niches as legionella.
Regarding b), a list of the minimum number of strains to be tested is given in 10.2. For strains not
belonging to the genus Legionella, no amplification product shall be detected by the real-time PCR. The
specificity of the probes and primers shall be evaluated on each new strain of legionella described as a
pathogen for humans (described and referenced at the WDCM).
For L. pneumophila the sequences described below are compatible with the list of strains to be tested
for specificity. Other sequences may be used as long as they match the exclusivity and inclusivity
requirements (see the list in 10.2).
There follow examples of primers (7.3.2.2 and 7.3.2.3) and probes (7.3.2.4) designed to amplify and
quantify the L. pneumophila specific fragment of mip (7.3.2.5).
These preparations are given as examples and shall be validated according to Clause 10.
7.3.2.2 Forward primer L. pneumophila: LpneuF, with the following composition.
Sequence 5’-CCGATGCCACATCATTAGC-3’
TE buffer (6.5.3.2) diluted 10 times.
LpneuF is prepared as follows. Prepare a stock solution of primers in 10 times diluted TE buffer at a
final concentration of 100 μmol/l. Store this stock solution below –18 °C. Dilute the stock solution to a
working solution of 10 μmol/l. For the preparation of both the stock solution and the working solution,
use a 10 times diluted TE buffer. Store this working solution for up to six months below –18 °C.
7.3.2.3 Reverse primer L. pneumophila: LpneuR, with the following composition.
Sequence 5’-CCAATTGAGCGCCACTCATAG-3’
TE buffer (6.5.3.2) diluted 10 times.
LpneuR is prepared as in a similar fashion to LpneuF (7.3.2.2).
7.3.2.4 Probe L. pneumophila: LpneuP, with the following composition.
Sequence 5’-TGCCTTTAGCCATTGCTTCCG-3’
Label 5’: Fluorophore (carboxyfluorescein, FAM)
Label 3’: Quencher (black hole quencher 1, BHQ1)
TE buffer (6.5.3.2)
LpneuP is prepared as follows. Resuspend the freeze-dried probe in the 10-fold diluted TE buffer to a
final concentration of 100 μmol/l. Store the stock solution below –18 °C. Dilute the stock solution with
TE-buffer (6.5.3.2) diluted 10 times to make a working solution of 10 μmol/l. Store the working solution
for up to six months below –18 °C.
7.3.2.5 DNA sequence of mip fragment of L. pneumophila.
5’-CCGATGCCACATCATTAGCTACAGACAAGGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGA
AGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTA
TGAGTGGCGCTCAATTGG-3’
7.3.3 Amplification mix preparation
Ideally, prepare the reaction mixtures immediately before use. If the reaction mix is stored, then its
stability requires validation by performing a verification of the linearity of the calibration function after
storage (see 10.3). This validation shall meet the criteria defined in 10.3.4.
The reaction mix and the extracted DNA shall be mixed just before amplification. To prevent the
consequences of accidental contamination, PCR amplifications can be performed from dUTP to activate
a UNG (uracil-DNA N-glycosylase) which removes all traces of amplicon before any new amplification.
The composition of a qPCR mix is given in Table 2. This composition is given as an example and shall be
validated according to Clause 10.
Mix the components in the proportion indicated in Table 2. Prepare the PCR mix just before use.
7.4 Quantitative detection
7.4.1 General
This detection shall enable detection and quantification of specific amplicons for Legionella spp. and/or
L. pneumophila.
The specificity of the quantitative PCR shall be guaranteed by using specific hybridization probe(s).
To ensure the quality of the quantitative detection, it is necessary to use a) and b).
a) An external DNA standard range, i.e. L. pneumophila-calibrated DNA solutions, derived from the
primary standard (see 11.2).
b) A PCR inhibition control, such as a calibrated solution of plasmid or oligonucleotide or L. pneumophila
genome unit, co-amplified with the DNA from the sample. This approach shall be used to reveal any
inhibitor presence in the sample DNA extract (see 11.6).
It is necessary to amplify the external calibrated standards and the inhibition control using the same
primers used to amplify the target sequences of the sample.
10 © ISO 2012 – All rights reserved

In approaches a) and b), quantification is performed by interpolation within the linear response range
of the DNA quantification method. This concentration range shall be determined beforehand (10.3).
The extracted DNA can, if necessary, be diluted to obtain a concentration situated within this linear
response area.
The amplification shall be performed with a real-time PCR thermocycler with a sufficient number of
cycles. This number of cycles shall not be less than the estimated value of the ordinate intercept (refer
to 10.3) increased by 5.
IMPORTANT — It is recommended, whenever possible, to carry out several tests using the same
DNA extract. Repeating tests and obtaining a mean result improves accuracy.
Table 2 — Composition of the qPCR mix
Volume per sample
Reagents Final concentration
μl
BSA for PCR applications 5 0,4 μg/μl
a
Taq polymerase (3.13) 1 0,1 U/μl
PCR buffer (Table 1) 5 1×
dNTPs (Table 1) 1 400 nmol/l
a
MgCl (Table 1) 3 According to the Taq DNA polymer-
ase requirements
Primer LpneuF (7.3.2.2) 1 200 nmol/l
Primer LpneuR (7.3.2.3) 1 200 nmol/l
Probe LpneuP (7.3.2.4) 1 200 nmol/l
Water for PCR applications make up to 40
PCR inhibition control shall be added according to 10.6.
a
The volume required depends on the concentration in the stock solutions and can vary with supplier.
7.4.2 Protocol
7.4.2.1 Introduction
The thermocycler programme in Table 3 is indicated as an example for the detection of L. pneumophila
by using the primers and probe sequences specified in 7.3.2.
This programme shall be adapted according to the model and the type of the thermocycler and shall be
validated according to the requirements stated in Clause 10.
Table 3 — Temperature and time programme of PCR
Denaturing of DNA and activation of hot-start Taq polymerase 3 min at 95 °C
20 s at 95 °C
DNA replication
60 s at 60 °C
Number of cycles 43
The programme shall be set in such a way that, during the DNA replication, the fluorescence signals of
the L. pneumophila specific probe and the PCR internal control specific probe are measured.
NOTE The duration of the hot-start step depends on the Taq DNA polymerase used and is stated on the
product specification from the manufacturer.
7.4.2.2 General
The following approach can be used for detection or quantification of amplicons.
Monitoring of the PCR is based on the measurement of a fluorescent signal due to hybridization of at
least one fluorescent labelled probe internal to the amplicon.
A working calibration range (external) comprising at least four levels (for example, solutions at 25 GU,
250 GU, 2 500 GU, and 25 000 GU of L. pneumophila per reaction tube) is prepared using the working
calibration solution (commercial solution or solution prepared according to Annex A). The first point of
the DNA range shall be equal to the quantification limit LQ .
qPCR
The working calibration solution shall be connected to the legionella DNA primary standard (see 11.2).
An expiration date for this solution shall be set for the planned storage conditions and verified by
coupling to the primary standard.
At least once during each sample amplification series (same PCR reagent batches, same materials), this
working calibration range shall be analysed under the same conditions as that used for the samples.
The stability of the calibration within a series and/or the reuse of a diluted range shall be verified by
measuring the reference material upon each use of the thermocycler (see 11.3).
7.4.2.3 Real-time quantification
Aside from the fact that real-time thermocyclers can detect amplification products on site, they are
also particularly appropriate for quantitative PCR. The detection systems enabl
...