oSIST prEN 17881:2022
(Main)Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment
Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment
This document describes a procedure for the identification of single bivalves to the level of genus or species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene [1], [2] followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases [5]. The methodology allows the identification of a large number of commercially important bivalve species.
This method has been successfully validated on raw mussels, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species.
Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand eines definierten mitochondrialen 16S rRNA‑Genabschnittes
Dieses Dokument beschreibt ein Verfahren für die Identifizierung von einzelnen Muscheln auf Gattungs- oder Speziesebene.
Die Identifizierung der Muschelspezies erfolgt durch PCR-Amplifikation eines Segments des mitochondrialen 16S rRNA-Gens [1] [2], gefolgt von der Sequenzierung der PCR-Produkte und einem anschließenden Daten¬bankabgleich der Sequenzen [5]. Diese Vorgehensweise ermöglicht die Identifizierung einer großen Anzahl kommerziell bedeutender Muschelspezies.
Dieses Verfahren wurde erfolgreich an rohen Muscheln validiert, Laborerfahrungen zeigen jedoch, dass dieses Verfahren auch an verarbeiteten Proben, wie z. B. kalt- und heißgeräucherten, gesalzenen, tiefgefrorenen, gekochten, gebratenen und frittierten Proben, angewendet werden kann.
Für die Untersuchung stark verarbeiteter Lebensmittel, wie z. B. Muschelkonserven mit stark degradierter DNA, bei denen die Fragmentlängen nicht für eine Amplifikation der Zielsequenzen ausreichen, ist dieses Dokument in der Regel nicht geeignet. Außerdem ist es nicht anwendbar auf zusammengesetzte Meeresfrüchteprodukte, die mehr als eine Muschelspezies enthalten.
Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Le présent document décrit un mode opératoire d’identification des bivalves au niveau du genre ou de l’espèce.
L’identification de l’espèce de bivalve est effectuée par amplification PCR d’un segment du gène de l’ARNr 16S mitochondrial [1], [2], suivie du séquençage des produits de PCR puis de la comparaison des séquences avec les entrées présentes dans les bases de données [5]. La méthode permet d'identifier un grand nombre d’espèces de bivalves importantes sur le plan commercial.
Cette méthode a été validée avec succès sur les moules crues. Toutefois, les expériences en laboratoire montrent qu’elle peut également être appliquée aux échantillons transformés, par exemple fumés à froid, fumés à chaud, salés, congelés, cuits, frits, frits dans l’huile.
D’une façon générale, le présent document ne convient pas à l’analyse d’aliments hautement transformés, par exemple les moules en conserve, contenant de l’ADN fortement dégradé dans lequel les longueurs de fragment ne sont pas suffisantes pour amplifier les cibles. Par ailleurs, il n’est pas applicable aux produits complexes à base de fruits de mer contenant des mélanges d’au moins deux espèces de bivalves.
Pristnost živil - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz školjk, z uporabo definiranega mitohondrijskega genskega segmenta 16S rRNA
General Information
Standards Content (Sample)
SLOVENSKI STANDARD
oSIST prEN 17881:2022
01-oktober-2022
Avtentičnost hrane - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz
školjk, z uporabo segmentov genov, ki nosijo zapis za mitohondrijski 16S rRNA
Food authenticity - DNA barcoding of bivalves and products derived from bivalves using
a defined mitochondrial 16S rRNA gene segment
Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand
eines definierten mitochondrialen 16S rRNA‑Genabschnittes
Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de
bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Ta slovenski standard je istoveten z: prEN 17881
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.30 Ribe in ribji proizvodi Fish and fishery products
oSIST prEN 17881:2022 en,fr,de
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
---------------------- Page: 1 ----------------------
oSIST prEN 17881:2022
---------------------- Page: 2 ----------------------
oSIST prEN 17881:2022
DRAFT
EUROPEAN STANDARD
prEN 17881
NORME EUROPÉENNE
EUROPÄISCHE NORM
July 2022
ICS 07.080; 67.020; 67.120.30
English Version
Food authenticity - DNA barcoding of bivalves and
products derived from bivalves using a defined
mitochondrial 16S rRNA gene segment
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von
de bivalves et produits dérivés de bivalves à l'aide d'un Muscheln und Muschelprodukten anhand eines
segment défini du gène de l'ARNr 16S mitochondrial definierten mitochondrialen 16S rRNA-Genabschnittes
This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee
CEN/TC 460.
If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations
which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.
This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other
language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC
Management Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are
aware and to provide supporting documentation.
Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without
notice and shall not be referred to as a European Standard.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2022 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 17881:2022 E
worldwide for CEN national Members.
---------------------- Page: 3 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 7
5 Reagents and materials . 7
5.1 General . 7
5.2 PCR reagents . 7
6 Apparatus . 8
7 Procedure. 8
7.1 Sample preparation . 8
7.2 DNA extraction . 8
7.3 PCR . 8
7.3.1 General . 8
7.3.2 PCR setup . 8
7.3.3 Temperature-time program . 9
7.3.4 PCR controls . 9
8 Evaluation . 10
8.1 Evaluation of PCR products . 10
8.2 Evaluation of the PCR results . 10
8.3 Sequencing of PCR products . 10
8.4 Evaluation of sequence data . 11
8.5 Comparison of the sequence with public databases. 11
8.5.1 General . 11
8.5.2 Sequence comparison of 16S rRNA gene sequences with GenBank . 11
9 Interpretation of database query results . 12
10 Validation status and performance criteria . 12
10.1 Collaborative study for the identification of bivalve species based on 16S rRNA gene
sequence analysis . 12
11 Test report . 14
Annex A (informative) Practical laboratory experiences with the amplificability of 16S
rRNA gene segments from tested bivalve species . 15
Bibliography . 16
2
---------------------- Page: 4 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
European foreword
This document (prEN 17881:2022) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to the CEN Enquiry.
3
---------------------- Page: 5 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
Introduction
Food safety is a key aspect in terms of consumer protection. In the last three decades, globalization has
taken place in the trade of food. Seafood trade channels are becoming steadily longer and more
complicated so that sophisticated traceability tools are needed to ensure food safety. Correct food
labelling is a prerequisite to ensure safe seafood products and fair trade as well as to minimize illegal,
unreported and unregulated (IUU) fishing. Seafood products are increasingly being processed in export
countries. Especially bivalves are often sold without the shells. That makes the identification of species
by morphological characteristics impossible.
The development of harmonized and standardized protocols for the authentication of bivalve products is
necessary to establish reliable methods for the detection of potential food fraud.
4
---------------------- Page: 6 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
1 Scope
This document describes a procedure for the identification of single bivalves to the level of genus or
species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial
16S rRNA gene [1], [2] followed by sequencing of the PCR products and subsequent sequence comparison
with entries in databases [5]. The methodology allows the identification of a large number of
commercially important bivalve species.
This method has been successfully validated on raw mussels, however, laboratory experience is available
that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-
fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with
highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets.
Furthermore, it is not applicable for complex seafood products containing mixtures of two or more
bivalve species.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Terms and definitions
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminological databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
process or result of matching up the nucleotide residues of two or more biological sequences to achieve
maximal levels of identity
[SOURCE: BLAST Glossary]
3.2
BLAST
Basic Local Alignment Search Tool [3]
sequence comparison algorithm optimized for speed used to search sequence databases for optimal local
alignments to a query
Note 1 to entry: It directly approximates alignments that optimize a measure of local similarity, the maximum
signal pair (MSP) score or high scoring signal pair (HSP) score.
5
---------------------- Page: 7 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
3.3
FASTA format
text-based format for representing either nucleotide sequences or amino acid sequences, which begins
with a single-line description, followed by lines of sequence data
Note 1 to entry: The description line (defline) is distinguished from the sequence data by a greater-than (“>”)
symbol at the beginning.
EXAMPLE An example sequence in FASTA format is shown below:
> Sample_04_16SrRNA gene
ATCACGTAGGATTTTAATGGGCGAACATACCAACCATTGAGACCGCCTACAGCCTCAGGATATCCGGAGCCAACATCGAGG
TCGCAAACTTTCTCATCTATAAGAACTATCAAAGAAAATAACGCTGTTATCCCCGGAGTAACTTCTTCTGTTAATCACTAA
ATAAAGTAAGTGGGTCGTCTATCAAACAAAGAAAAGAAAGAGTCTGATCTTGCTCTTTTGCTGCCCCAGCCAACAACAAAA
GTGGTAAGAATATCTCTGCCACTTAGTTAACAACTTCACGGGGTCTTCTCGTCTATCACTTATATTTAAGCATTTGCACTT
AAAATTCAATTTCATATAATTCAGCTAGAGACAGTTATAGGCTCGTCAATCCATTCACAGGGCCCCCAATTAGAGGGCCAT
AATTTAGCTACCTTAGCACGCTTTACCGCATCCGTTTAAGTCATCTCACTGGGAAGGAACGACCTACTATAAATACAGTAG
GCCATGTTTTT
[SOURCE: BLAST topics, modified]
3.4
GenBank
comprehensive public database of e.g. genetic sequences [5]
Note 1 to entry: GenBank is part of the International Nucleotide Sequence Database Collaboration, which
comprises the DNA DataBank of Japan (DDBJ), the European Nucleotide Archive (ENA), and GenBank at National
Center for Biotechnology Information (NCBI). These three organizations exchange data on a daily basis.
3.5
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
[Source: BLAST Glossary]
3.6
introgressed DNA
DNA sequence (allele) from one taxonomic entity (species) incorporated in the gene pool of another,
divergent entity (species) [6]
Note 1 to entry: Introgression has usually happened via hybridization and backcrossing of individuals belonging
to different species.
3.7
NCBI
National Center for Biotechnology Information
institution which houses molecular biology databases (e.g. GenBank) and provides the BLAST suite
3.8
nucleotide collection
nr/nt
non-redundant database consisting of GenBank sequences, in which identical sequences have been
merged into one entry
6
---------------------- Page: 8 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
3.9
query
sequence (or other type of search term) to which all of the entries in a data base are to be compared
[SOURCE: BLAST Glossary]
3.10
query coverage
percentage of query covered by alignment to the data base sequence
[SOURCE: BLAST help]
4 Principle
DNA is extracted from bivalves and bivalves products applying a suitable method. A segment of
approximately 550 base pairs (bp) of the 16S rRNA gene is amplified by PCR. In the further course, the
nucleotide sequence of the PCR product is determined by a suitable DNA sequencing method (e.g. Sanger
sequencing). The sequence is evaluated by comparison to sequence entries in databases, thus allowing
the assignment to a bivalve species or genus according to the degree of identity with stored sequences.
5 Reagents and materials
5.1 General
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled or demineralized water or water of equivalent purity, according to ISO 20813. Regarding
laboratory organization, see ISO 20813.
5.2 PCR reagents
1
5.2.1 Thermostable DNA polymerase (for hot start PCR)
1
5.2.2 PCR reaction buffer (including MgCl or with separate MgCl solution)
2 2
2
5.2.3 Deoxynucleoside triphosphate mix (dATP, dCTP, dGTP and dTTP)
5.2.4 Oligonucleotides (see Table 1)
Table 1 — Oligonucleotides for amplification of the 16S rRNA gene region [1], [2]
Name DNA Sequence of oligonucleotide
16SAR 5'-CGC CTG TTT ATC AAA AAC AT-3'
16SBR 5'-CCG GTC TGA ACT CAG ATC ACG T-3'
5.2.5 Agarose
5.2.6 Suitable DNA length standard for assessing the amplification product length
1
During the collaborative study the laboratories used DNA polymerases and mastermixes of different
commercial providers. Amplificates were produced successfully with all used mastermixes and DNA polymerases.
2
Deoxynucleotide triphosphates can also be part of a commercial PCR master mix.
7
---------------------- Page: 9 ----------------------
oSIST prEN 17881:2022
prEN 17881:2022 (E)
6 Apparatus
Apart from the usual laboratory equipment, the following equipment is required:
6.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA
6.2 Thermocycler
6.3 Gel electrophoresis device
6.4 Gel documentation system
6.5 DNA sequencer
7 Procedure
7.1 Sample preparation
It shall be ensured that the test portion used for DNA extraction is representative for the laboratory
sample. In composed samples (e.g. seafood mixtures), single pure bivalve pieces have to be separated and
analysed. With the analysis of samples composed of several pieces (e.g. bags with different scallops), test
portions for every putative bivalve species are taken and analysed separately. To minimize the risk of
amplifying adhering contaminants, test sample material shall not be taken from the surface of the
laboratory sample. For further information regarding sample preparation, see ISO 20813.
7.2 DNA extraction
Concerning the extraction of DNA from the test sample, the general instructions and measures described
in EN ISO 21571 should be followed, see ISO 20813. It is recommended to choose one of the DNA
3
extraction methods described in EN ISO 21571:2005 , Annex A. Alternatively, commercial kits can be
used for the extraction and purification of DNA.
7.3 PCR
7.3.1 General
The primers used for the amplification of the section from the mitochondrial 16S rRNA gene are universal
primers. The primer pair 16SAR / 16SBR has been tested against a broad taxonomic range of bivalve
species, and has only failed in a small minority of cases (< 5 % of species tested) [1].
7.3.2 PCR setup
The method was validated for a total volume of 25 µl per PCR. The reagents given in Table 2 should be
used for the 16S rRNA PCR.
Reagents are completely thawed at room temperature and should be centrifuged briefly before usage. A
PCR reagent mixture is prepared containing all PCR components in the given concentrations except for
the DNA extract. The amount of PCR mixture depends on the total volume per PCR and the total number
of the reactions including a su
...
Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.