prEN 18057
(Main)Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and meat products
Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and meat products
This document specifies a real-time PCR procedure for the quantification of the amount of roe deer DNA relative to total mammalian and poultry DNA in meat and meat products.
The results of this assay for roe deer are expressed in terms of roe deer (Capreolus capreolus) haploid genome copy numbers relative to mammalian total haploid genome copy numbers. The content of roe deer can also be expressed as a percentage by mass using gravimetrically prepared calibration material from meat mixtures or model samples.
The method has been previously validated in a collaborative trial and applied to DNA extracted from samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled sausages.
The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene copies or 0,03 % roe deer.
The compliance assessment process is not part of this document.
Lebensmittelauthentizität - Quantifizierung von Reh-DNA im Verhältnis zu Säugetier-DNA in Fleisch und Fleischprodukten
Authenticité des aliments - Quantification de l'ADN de chevreuil par rapport à l'ADN de mammifère dans la viande et les produits carnés
Pristnost živil - Kvantitativno določanje DNK srnjadi glede na DNK sesalcev v mesu in mesnih izdelkih
General Information
Standards Content (Sample)
SLOVENSKI STANDARD
01-april-2024
Pristnost živil - Kvantitativno določanje DNK srnjadi glede na DNK sesalcev v
mesu in mesnih izdelkih
Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and
meat products
Lebensmittelauthentizität - Quantifizierung von Reh-DNA im Verhältnis zu Säugetier-
DNA in Fleisch und Fleischprodukten
Authenticité des aliments - Quantification de l'ADN de chevreuil par rapport à l'ADN de
mammifère dans la viande et les produits carnés
Ta slovenski standard je istoveten z: prEN 18057
ICS:
07.100.30 Mikrobiologija živil Food microbiology
67.120.10 Meso in mesni proizvodi Meat and meat products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
DRAFT
EUROPEAN STANDARD
NORME EUROPÉENNE
EUROPÄISCHE NORM
February 2024
ICS 67.120.10; 07.100.30
English Version
Food authenticity - Quantitation of roe deer DNA relative
to mammalian DNA in meat and meat products
Authenticité des aliments - Quantification de l'ADN de Lebensmittelauthentizität - Quantifizierung von Reh-
chevreuil par rapport à l'ADN de mammifère dans la DNA im Verhältnis zu Säugetier-DNA in Fleisch und
viande et les produits carnés Fleischprodukten
This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee
CEN/TC 460.
If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations
which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.
This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other
language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC
Management Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are
aware and to provide supporting documentation.
Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without
notice and shall not be referred to as a European Standard.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 18057:2024 E
worldwide for CEN national Members.
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 5
5 Reagents and materials . 6
6 Apparatus . 7
7 Procedure . 7
7.1 Preparation of the test portion/sample . 7
7.2 Preparation of DNA extracts . 7
7.3 Preparation of roe deer and mammalian calibration standards . 8
7.4 PCR setup . 8
7.4.1 Samples and controls . 8
7.4.2 Reaction mixes . 8
7.4.3 Real-time PCR thermocycler plate set-up . 9
7.4.4 Temperature-time program . 9
8 Accept/reject criteria . 9
8.1 General. 9
8.2 Data analysis . 10
9 Validation status and performance criteria . 11
9.1 General. 11
9.2 Repeatability . 13
9.3 Reproducibility . 13
9.4 Recovery . 13
9.5 Limit of detection (LOD) . 13
9.6 Specificity . 14
10 Test report . 14
Bibliography . 17
European foreword
This document (prEN 18057:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to CEN Enquiry.
Introduction
Food authenticity and integrity are key aspects in terms of consumer protection. In the last three decades,
globalization has taken place in the trade of food. During the last decades, a lot of methods applying PCR
and particularly real-time PCR protocols for the identification of animal species used for food
consumption (e.g. pig, cattle, sheep, horse, chicken and turkey) have been established.
Game meat is particularly susceptible to fraudulent labelling since it is more valuable than meat from
domestic animals. A variety of game meat products, commonly containing red deer or roe deer, is
commercially available. For verifying correct labelling of commercial game meat products, the
development of harmonized and standardized protocols for the authentication of meat products is
important to establish reliable methods for the detection of potential food fraud.
1 Scope
This document specifies a real-time PCR procedure for the quantification of the amount of roe deer DNA
relative to total mammalian and poultry DNA in meat and meat products.
The results of this assay for roe deer are expressed in terms of roe deer (Capreolus capreolus) haploid
genome copy numbers relative to mammalian total haploid genome copy numbers. The content of roe
deer can also be expressed as a percentage by mass using gravimetrically prepared calibration material
from meat mixtures or model samples.
The method has been previously validated in a collaborative trial and applied to DNA extracted from
samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled
sausages.
The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene
copies or 0,03 % roe deer.
The compliance assessment process is not part of this document.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
EN ISO 20813, Molecular biomarker analysis - Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) - General requirements and
definitions (ISO 20813)
EN ISO 21571, Foodstuffs - Methods of analysis for the detection of genetically modified organisms and
derived products - Nucleic acid extraction (ISO 21571)
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https://www.iso.org/obp/
— IEC Electropedia: available at https://www.electropedia.org/
4 Principle
Test samples containing roe deer DNA in a background of DNA from other mammalian or poultry species
are analysed by a relative quantitation approach utilizing singleplex qPCR assays targeting the promotor
[1] [2]
region of the lactoferrin gene of roe deer and the myostatin gene present in mammals and poultry.
DNA template concentration is quantified prior to the real-time PCR to normalize test input levels. DNA
from model meat mixtures derived from authenticated roe deer meat in the meat background of other
mammalian species are extracted or solutions of genomic roe deer DNA and DNA of other mammalian
species are used and diluted to generate separate calibration curves for both the roe deer-specific target
and the mammalian target. Test samples extracted in the same manner as the calibration standards are
evaluated in the same PCR run using the roe deer-specific and universal mammalian qPCR assays. DNA
concentrations of roe deer and mammalian DNA are determined for the test samples using the roe deer
and mammalian calibration curves. The percentage of roe deer DNA content in the test sample is
expressed as a ratio of the amount of roe deer DNA relative to the total mammalian DNA present in the
sample.
5 Reagents and materials
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled or demineralized water or water of equivalent purity, according to EN ISO 20813. Regarding
laboratory organization, see EN ISO 20813. Although it is not obligatory to use the reagents,
instrumentation or conditions specified in the standard, if a laboratory chooses not to do so, then it is the
responsibility of that laboratory to validate the results obtained.
5.1 PCR master mix
PCR master mix contains thermostable DNA polymerase, pH buffer, KCl, MgCl , and the four dNTPs (dATP,
1,2
dCTP, dGTP and dUTP) as a dilutable concentrate, which is ready-to-use .
5.2 Oligonucleotides
The quality of the oligonucleotides shall be sufficient for their use as primers and probes. See Table 1 and
Table 2.
[1]
Table 1 — Oligonucleotides for amplification of the roe deer-specific gene region
Final concentration
Name DNA sequence of oligonucleotide
in PCR
a
Roe deer promotor region of the lactoferrin gene, GenBank® accession number AY122040
roe deer 2a FW 0,2 µM
5'-TGGCTGCTGCGTGCAGAA-3’
(Forward primer)
roe deer 2a RV 0,2 µM
5’-TCTAAAATGCTTGGGAACCAGATAT-3’
(Reverse primer)
roe deer 2a Pr 0,1 µM
b
5'-[FAM]-GAAGGGTCTCCGTCTGC-[NFQ-MGB] -3'
(Probe)
a
PCR product = 212 – TGGCTGCTGCGTGCAGAATGAAGGGTCTCCGTCTGCCATATCTGGTTCCCAAGCATT
TTAGA – 273
b
FAM: 6-Carboxy fluorescein, NFQ-MGB: Non-fluorescent quencher minor groove binder
[2]
Table 2 — Oligonucleotides for amplification of the mammalian and poultry gene region
Final concentration
Name DNA Sequence of oligonucleotide
in PCR
a
Myostatin gene, GenBank® accession number AF320998
MYw-f 5'-TTGTGCARATCCTGAGACTCAT-3' 0,2 µM
(Forward primer)
1 ®
During the collaborative study QuantiTect Multiplex PCR Kit (Qiagen) was used. This information is given for the
convenience of users of this document and does not constitute an endorsement by CEN of the products named. Equivalent
products may be used if they can be shown to lead to the same results.
The formulation of PCR Master Mix employed must be suitable for use with th
...
Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.