General Information

Abstract

This document specifies a real-time PCR procedure for the quantitation of the amount of roe deer DNA relative to total mammalian DNA in meat and meat products.
Results of this roe deer assay are expressed in terms of roe deer (Capreolus capreolus) haploid genome copy numbers relative to total mammalian haploid genome copy numbers. The content of roe deer can also be expressed as mass fraction in % using gravimetrically prepared calibration material from meat mixtures or model samples.
The method has been previously validated in a collaborative study and applied to DNA extracted from samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled sausages.
The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene copies or at least 0,1 % roe deer.
The compliance assessment process is not part of this document.

Status
Published
Public Enquiry End Date
29-Apr-2024
Publication Date
14-Jul-2025
Current Stage
6060 - National Implementation/Publication (Adopted Project)
Start Date
30-Jun-2025
Due Date
04-Sep-2025
Completion Date
15-Jul-2025

Buy Documents

Standard

SIST EN 18057:2025

English language (16 pages)
Preview
Preview
e-Library read for
×1 day

Overview

EN 18057:2025 (CEN) - "Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and meat products by real‑time PCR" - defines a standardized real‑time PCR method for measuring roe deer (Capreolus capreolus) DNA as a proportion of total mammalian DNA in meat and meat products. Results are reported as haploid genome equivalents (HGE) (roe deer HGE relative to total mammalian HGE) and can be converted to mass fraction (%) using gravimetrically prepared calibration materials. The method has been validated in a collaborative study and applied to samples including raw roe deer in pig meat backgrounds and raw/boiled sausages. The document does not cover compliance assessment.

Key topics and technical requirements

  • Analytical principle: Relative quantitation using singleplex real‑time PCR assays - roe deer‑specific target (lactoferrin promoter) and a universal mammalian target (myostatin).
  • Calibration and quantitation: Separate calibration curves for roe deer and mammalian targets using authenticated genomic DNA or model meat mixtures; conversion to mass fraction via gravimetric calibration.
  • Limit of detection (LOD): Experimentally determined to be at least 5 target gene copies or ≥ 0.1% roe deer.
  • Sample preparation and DNA extraction: Test portion homogenization and DNA extraction in line with EN ISO 20813 and EN ISO 21571; DNA quality checks (spectrophotometric ratios) are required.
  • Reagents and instrumentation: Use of molecular biology grade reagents, hydrolysis probe chemistry, and a compatible real‑time PCR thermocycler capable of fluorescence detection.
  • Performance and validation: Guidance and criteria for repeatability, reproducibility, recovery, specificity and accept/reject criteria from the collaborative validation.
  • Controls and reporting: Inclusion of calibration standards, negative and positive controls, and standardized test reporting requirements.

Applications and users

This standard is intended for:

  • Food testing and authenticity laboratories verifying game meat labeling.
  • Regulatory and official control authorities investigating food fraud.
  • Meat processors and quality assurance teams performing supplier verification.
  • Reference and research laboratories developing validated assays for species quantitation.

Practical uses include detection and quantitation of undeclared roe deer in processed and unprocessed meat products, supporting traceability, labelling compliance checks (investigative), and fraud prevention.

Related standards

  • EN ISO 11781 - single‑laboratory validation of qualitative real‑time PCR
  • EN ISO 20813 - nucleic acid‑based methods for species detection in foods
  • EN ISO 21571 - nucleic acid extraction for foodstuffs
  • ISO 16577 - vocabulary for molecular biomarker methods

Keywords: EN 18057:2025, food authenticity, roe deer DNA, real‑time PCR, quantitation, meat products, limit of detection, haploid genome equivalents, CEN.

Relations

Effective Date
28-Jan-2026
Effective Date
28-Jan-2026
Effective Date
28-Jan-2026
Effective Date
28-Jan-2026
Effective Date
28-Jan-2026

Buy Documents

Standard

SIST EN 18057:2025

English language (16 pages)
Preview
Preview
e-Library read for
×1 day

Get Certified

Connect with accredited certification bodies for this standard

BSI Group

BSI (British Standards Institution) is the business standards company that helps organizations make excellence a habit.

UKAS United Kingdom Verified

Bureau Veritas

Bureau Veritas is a world leader in laboratory testing, inspection and certification services.

COFRAC France Verified

DNV

DNV is an independent assurance and risk management provider.

NA Norway Verified

Sponsored listings

Frequently Asked Questions

SIST EN 18057:2025 is a standard published by the Slovenian Institute for Standardization (SIST). Its full title is "Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and meat products by real-time PCR". This standard covers: This document specifies a real-time PCR procedure for the quantitation of the amount of roe deer DNA relative to total mammalian DNA in meat and meat products. Results of this roe deer assay are expressed in terms of roe deer (Capreolus capreolus) haploid genome copy numbers relative to total mammalian haploid genome copy numbers. The content of roe deer can also be expressed as mass fraction in % using gravimetrically prepared calibration material from meat mixtures or model samples. The method has been previously validated in a collaborative study and applied to DNA extracted from samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled sausages. The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene copies or at least 0,1 % roe deer. The compliance assessment process is not part of this document.

This document specifies a real-time PCR procedure for the quantitation of the amount of roe deer DNA relative to total mammalian DNA in meat and meat products. Results of this roe deer assay are expressed in terms of roe deer (Capreolus capreolus) haploid genome copy numbers relative to total mammalian haploid genome copy numbers. The content of roe deer can also be expressed as mass fraction in % using gravimetrically prepared calibration material from meat mixtures or model samples. The method has been previously validated in a collaborative study and applied to DNA extracted from samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled sausages. The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene copies or at least 0,1 % roe deer. The compliance assessment process is not part of this document.

SIST EN 18057:2025 is classified under the following ICS (International Classification for Standards) categories: 07.100.30 - Food microbiology; 67.120.10 - Meat and meat products. The ICS classification helps identify the subject area and facilitates finding related standards.

SIST EN 18057:2025 has the following relationships with other standards: It is inter standard links to kSIST FprEN 890:2026, SIST EN ISO 20813:2023, SIST EN ISO 21571:2005/A1:2013, SIST EN ISO 11781:2025, SIST EN ISO 21571:2005. Understanding these relationships helps ensure you are using the most current and applicable version of the standard.

SIST EN 18057:2025 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.

Standards Content (Sample)


SLOVENSKI STANDARD
01-september-2025
Pristnost živil - Kvantitativno določanje DNK srnjadi glede na DNK sesalcev v
mesu in mesnih izdelkih s PCR v realnem času
Food authenticity - Quantitation of roe deer DNA relative to mammalian DNA in meat and
meat products by real-time PCR
Lebensmittelauthentizität - Quantifizierung von Reh-DNA im Verhältnis zu Säugetier-
DNA in Fleisch und Fleischprodukten mittels Real-time-PCR
Authenticité des aliments - Quantification de l’ADN de chevreuil par rapport à l’ADN de
mammifère dans la viande et les produits carnés par PCR en temps réel
Ta slovenski standard je istoveten z: EN 18057:2025
ICS:
07.100.30 Mikrobiologija živil Food microbiology
67.120.10 Meso in mesni proizvodi Meat and meat products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

EN 18057
EUROPEAN STANDARD
NORME EUROPÉENNE
June 2025
EUROPÄISCHE NORM
ICS 67.120.10
English Version
Food authenticity - Quantitation of roe deer DNA relative
to mammalian DNA in meat and meat products by real-
time PCR
Authenticité des aliments - Quantification de l'ADN de Lebensmittelauthentizität - Quantifizierung von Reh-
chevreuil par rapport à l'ADN de mammifère dans la DNA im Verhältnis zu Säugetier-DNA in Fleisch und
viande et les produits carnés Fleischprodukten
This European Standard was approved by CEN on 4 May 2025.

CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION

EUROPÄISCHES KOMITEE FÜR NORMUNG

CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2025 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 18057:2025 E
worldwide for CEN national Members.

Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 6
5 Principle . 6
6 Reagents and materials . 6
7 Apparatus . 8
8 Procedure . 8
8.1 Preparation of the test sample and test portion . 8
8.2 Preparation of DNA extracts . 8
8.3 Preparation of roe deer and mammalian calibration standards . 8
8.4 PCR setup . 9
8.4.1 Samples and controls . 9
8.4.2 Reaction mixes . 9
8.4.3 Thermal cycling . 10
9 Accept/reject criteria . 10
9.1 General. 10
9.2 Data analysis . 11
10 Validation status and performance criteria . 11
10.1 General. 11
10.2 Repeatability . 14
10.3 Reproducibility . 14
10.4 Recovery . 14
10.5 Limit of Detection (LOD) . 14
10.6 Specificity . 15
11 Test report . 15
Bibliography . 16

European foreword
This document (EN 18057:2025) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by December 2025, and conflicting national standards shall
be withdrawn at the latest by December 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Food authenticity and integrity are key aspects in terms of consumer protection. Since the late 1980s,
globalization has taken place in the trade of food. During the last decades, many of methods applying PCR,
particularly real-time PCR protocols, have been established for the identification of animal species used
for food consumption (e.g. pig, cattle, sheep, horse, chicken and turkey).
Game meat is particularly susceptible to fraudulent labelling since it is more valuable than meat from
domestic animals. A variety of game meat products, commonly containing red deer or roe deer, is
commercially available. For verifying the correct labelling of commercial game meat products, the
development of harmonized and standardized protocols for the authentication of meat products is
important to establish reliable methods for the detection of potential food fraud.
1 Scope
This document specifies a real-time PCR procedure for the quantitation of the amount of roe deer DNA
relative to total mammalian DNA in meat and meat products.
Results of this roe deer assay are expressed in terms of roe deer (Capreolus capreolus) haploid genome
copy numbers relative to total mammalian haploid genome copy numbers. The content of roe deer can
also be expressed as mass fraction in % using gravimetrically prepared calibration material from meat
mixtures or model samples.
The method has been previously validated in a collaborative study and applied to DNA extracted from
samples that consist of raw roe deer meat in a raw pig meat background as well as raw and boiled
sausages.
The limit of detection of the roe deer PCR has been determined experimentally to be at least 5 target gene
copies or at least 0,1 % roe deer.
The compliance assessment process is not part of this document.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
EN ISO 11781, Molecular biomarker analysis – Requirements and guidance for single-laboratory validation
of qualitative real-time polymerase chain reaction (PCR) methods (ISO 11781)
EN ISO 20813, Molecular biomarker analysis - Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) - General requirements and
definitions (ISO 20813)
EN ISO 21571:2005, Foodstuffs - Methods of analysis for the detection of genetically modified organisms
and derived products - Nucleic acid extraction (ISO 21571:2005)
ISO 16577, Molecular biomarker analysis - Vocabulary for molecular biomarker analytical methods in
agriculture and food production
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https://www.iso.org/obp/
— IEC Electropedia: available at https://www.electropedia.org/

As impacted by EN ISO 21571:2005/A1:2013.
4 Symbols and abbreviations
For the purposes of this document, the following symbols and abbreviations apply:
dNTP deoxyribonucleotide triphosphate
DNA deoxyribonucleic acid
PCR polymerase chain reaction
HGE haploid genome equivalents
A adenine
C cytosine
G guanine
R purine (guanine or adenine)
T thymine
5 Principle
Test samples containing roe deer DNA in a background of DNA from other mammalian species are
analysed by a relative quantitation approach utilizing singleplex real-time PCR assays targeting the
promoter region of the lactoferrin gene of roe deer [1] and the myostatin gene [2] present in mammals
and poultry. DNA template concentration is quantified prior to the real-time PCR to normalize test input
levels. DNA from model meat mixtures derived from authenticated roe deer meat in the meat background
of other mammalian species is extracted, or solutions of genomic roe deer DNA and DNA of other
mammalian species are used and diluted to generate separate calibration curves for both the roe deer-
specific target and the mammalian target.
Test samples extracted in the same manner as the calibration standards are evaluated in the same PCR
run using the roe deer-specific and universal mammalian real-time PCR assays. DNA concentrations of
roe deer and mammalian DNA are determined for the test samples using the roe deer and mammalian
calibration curves.
The percentage of roe deer DNA content in the test sample is expressed as a ratio of the amount of roe
deer DNA relative to the total mammalian DNA present in the sample.
6 Reagents and materials
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled or demineralized water or water of equivalent purity, according to EN ISO 20813. Regarding
laboratory organization, see EN ISO 20813.
Although it is not obligatory to use the reagents, instrumentation or conditions specified in this
document, when a laboratory chooses not to do so, then it is the responsibility of that laboratory to ensure
that the results obtained are fit for purpose.
6.1 PCR master mix
PCR master mix contains thermostable DNA polymerase, pH buffer, KCl, MgCl , and the four dNTPs (dATP,
dCTP, dGTP and dTTP) and dUTP as a dilutable concentrate, which is ready-to-use and suitable for the
2,3
make and model of thermocycler employed .
6.2 Oligonucleotides
The quality of the oligonucleotides shall be sufficient for their use as primers and probes, see Table 1 and
Table 2.
Table 1 — Oligonucleotides for amplification of the roe deer-specific gene region [1]
Final concentration
Name DNA sequence of oligonucleotide
in PCR
4 a
Roe deer promotor region of the lactoferrin gene, GenBank® accession number AY122040
roe deer 2a FW 0,2 µmol/L
5'-TGGCTGCTGCGTGCAGAA-3'
(Forward primer)
roe deer 2a RV 0,2 µmol/L
5’-TCTAAAATGCTTGGGAACCAGATAT-3'
(Reverse primer)
roe deer 2a Pr 0,1 µmol/L
b
5'-[FAM]-GAAGGGTCTCCGTCTGC-[NFQ-MGB]-3'
(Probe)
a
PCR product = 212 – TGGCTGCTGCGTGCAGAATGAAGGGTCTCCGTCTGCCATATCTGGTTCCCAAGCATTTTA
GA – 273
b
FAM: 6-Carboxy fluorescein, NFQ-MGB: Non-fluorescent quencher minor groove binder
Table 2 — Oligonucleotides for amplification of the mammalian gene region [2]
Final concentration
Name DNA sequence of oligonucleotide
in PCR
4 a
Myostatin gene, GenBank® accession number AF320998
MYw-f 5'-TTGTGCARATCCTGAGACTCAT-3' 0,2 µmol/L
(Forward primer)
MY-r 0,2 µmol/L
5’-ATACCAGTGCCTGGGTTCAT-3'
(Reverse primer)
MY-Probe 5'-[FAM]-CCCATGAAAGACGGTACAAGRTATACTG- 0,1 µmol/L
b
(Probe) [BHQ1]-3'
a
PCR product = 2500 – TTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACTGGAATC
CGATCTCTGAAACTTGACATGAACCCAGGCACTGGTAT – 2596
b
FAM: 6-Carboxy fluorescein, BHQ1: black hole quencher 1

During the collaborative study, QuantiTect® Multiplex PCR Kit (Qiagen) was used. This information is given for the
convenience of users of this document and does not constitute an endorsement by CEN of the products named. Equivalent
products may be used if they can be shown to lead to the same results.
The formulation of the PCR master mix employed must be suitable for use with the make and model of the thermocycler
employed. Equivalent products to those specified may be used if they can be demonstrated to lead to the same results.
GenBank® is a trademark of a product supplied by the National Center for Biotechnology Information (NCBI). This
information is given for the convenience of users of this document and does not constitute an endorsement by CEN
of these products.
6.3 Authentic roe deer DNA sample
The sample shall consist of raw muscle tissue trimmed free of surface inter-muscular fat and connective
tissue. The source material should be derived from an appropriate reference material, if available, or in-
house material authenticated through appropriate meat verification tests, e.g. DNA sequencing-based
analyses or verification by t
...