EN 18033:2024
(Main)Food authenticity - Quantitation of equine DNA relative to mammalian DNA in raw beef (meat)
Food authenticity - Quantitation of equine DNA relative to mammalian DNA in raw beef (meat)
This document specifies a real-time PCR procedure for the quantitation of the amount of equine DNA relative to total mammalian DNA in a raw meat sample.
Results of this equine assay are expressed in terms of equine (Equus genus) haploid genome copy numbers relative to total mammalian haploid genome copy numbers. This assay is specific for representatives of the genus Equus and therefore detects horse, mule, donkey and zebra DNA.
The method has been previously validated in a collaborative study and applied to DNA extracted from samples that consist of raw horse meat in a raw beef (meat) background.
The limit of detection has been determined experimentally to be at least 17 horse haploid genome equivalents (HGE) for both the equine PCR and the mammalian PCR based on the lowest dilution on the respective calibration curves through single laboratory validation. The lowest relative horse content of the target sequence included in the collaborative study was a mass fraction of 0,1 % based on gravimetrically prepared raw horse muscle tissue in a raw beef muscle tissue background.
The compliance assessment process is not part of this document.
Lebensmittelauthentizität - Quantifizierung von Equiden-DNA im Verhältnis zu Säugetier-DNA in rohem Rindfleisch
Dieses Dokument legt ein Real-time-PCR-Verfahren für die Quantifizierung der Menge an Equiden-DNA im Verhältnis zur gesamten Säugetier-DNA in einer Probe von rohem Fleisch fest.
Die Ergebnisse dieser Untersuchung auf Equiden (Equiden-Assay) werden in Form von Kopienzahlen des haploiden Genoms von Equiden (Gattung Equus) im Verhältnis zu den Kopienzahlen des haploiden Genoms von Säugetieren insgesamt ausgedrückt. Diese Untersuchung ist spezifisch für Vertreter der Gattung Equus und weist daher DNA von Pferden, Maultieren, Eseln und Zebras nach.
Das Verfahren wurde zuvor in einem Ringversuch validiert und auf DNA angewendet, die aus Proben extrahiert wurde, die aus rohem Pferdefleisch in rohem Rindfleisch als Hintergrund bestehen.
Die Nachweisgrenze wurde experimentell auf mindestens 17 haploide Genomäquivalente (HGE; en: haploid genome equivalents) vom Pferd sowohl für die Equiden-PCR als auch für die Säugetier-PCR auf der Grundlage der niedrigsten Verdünnung auf den jeweiligen Kalibrierkurven durch Einzellaborvalidierung bestimmt. Der niedrigste relative Pferdeanteil der in den Ringversuch einbezogenen Zielsequenz war ein Massenanteil von 0,1 % auf der Grundlage von gravimetrisch vorbereitetem rohem Pferde-Muskelgewebe in rohem Rinder-Muskelgewebe als Hintergrund.
Der Prozess der Konformitätsbewertung ist nicht Teil dieses Dokuments.
Authenticité des aliments - Quantification de l’ADN équin par rapport à l’ADN mammalien dans la viande de bœuf crue
Le présent document spécifie un protocole de PCR en temps réel pour quantifier l’ADN équin par rapport à l’ADN mammalien total dans un échantillon de viande crue.
Les résultats de cet essai équin sont exprimés comme le rapport du nombre de copies de génomes haploïdes équins (genre Equus) sur le nombre total de copies de génomes haploïdes mammaliens. Cet essai est spécifique des représentants du genre Equus et détecte donc l’ADN de cheval, de mulet, d’âne et de zèbre.
La méthode a déjà été validée par une étude interlaboratoires et appliquée à de l’ADN extrait d’échantillons constitués de viande crue de cheval sur une base de viande crue de boeuf.
La limite de détection a été déterminée par expérimentation comme étant égale à 17 équivalents génomes haploïdes (HGE - haploid genome equivalent) de cheval, pour la PCR équine et la PCR mammalienne, sur la base de la dilution la plus faible des courbes d’étalonnage respectives et par validation intralaboratoire. La plus petite quantité relative de viande de cheval de la séquence cible de l’étude interlaboratoires était une fraction massique de 0,1 % correspondant à des tissus musculaires crus de cheval préparés par gravimétrie sur une base de tissus musculaires crus de boeuf.
Le présent document ne traite pas du processus d’évaluation de la conformité.
Pristnost živil - Kvantitativno določanje DNK kopitarjev glede na DNK sesalcev v surovi govedini (meso)
General Information
Standards Content (Sample)
SLOVENSKI STANDARD
oSIST prEN 18033:2024
01-januar-2024
Avtentičnost živil - Kvantitativno določanje DNK kopitarjev glede na
DNK sesalcev v surovem govejem mesu (meso)
Food authenticity - Quantitation of equine DNA relative to mammalian DNA in raw beef
(meat)
Lebensmittelauthentizität - Quantifizierung von Equiden-DNA im Verhältnis zu Säugetier-
DNA in rohem Rindfleisch
Authenticité des aliments - Quantification de l’ADN équin par rapport à l’ADN mammalien
dans la viande de bœuf crue
Ta slovenski standard je istoveten z: prEN 18033
ICS:
07.100.30 Mikrobiologija živil Food microbiology
67.120.10 Meso in mesni proizvodi Meat and meat products
oSIST prEN 18033:2024 en,fr,de
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
oSIST prEN 18033:2024
oSIST prEN 18033:2024
DRAFT
EUROPEAN STANDARD
prEN 18033
NORME EUROPÉENNE
EUROPÄISCHE NORM
November 2023
ICS
English Version
Food authenticity - Quantitation of equine DNA relative to
mammalian DNA in raw beef (meat)
Authenticité des aliments - Quantification de l'ADN Lebensmittelauthentizität - Quantifizierung von
équin par rapport à l'ADN mammalien dans des Equiden-DNA im Verhältnis zu Säugetier-DNA in
échantillons de viande de boeuf crue rohem Rindfleisch
This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee
CEN/TC 460.
If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations
which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.
This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other
language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC
Management Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are
aware and to provide supporting documentation.
Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without
notice and shall not be referred to as a European Standard.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2023 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 18033:2023 E
worldwide for CEN national Members.
oSIST prEN 18033:2024
prEN 18033:2023 (E)
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 5
5 Reagents and materials . 6
6 Apparatus . 7
7 Procedure . 7
7.1 Preparation of the test portion/sample . 7
7.2 Preparation of DNA extracts . 8
7.3 Preparation of horse calibration standards. 8
7.4 PCR Setup . 8
8 Accept/Reject criteria . 10
8.1 General. 10
8.2 Data analysis . 10
9 Validation status and performance criteria . 11
9.1 General. 11
9.2 Repeatability . 11
9.3 Reproducibility . 11
9.4 Limit of Detection (LOD) . 12
9.5 Limit of Quantitation (LOQ) . 12
9.6 Specificity . 12
10 Test report . 13
Bibliography . 15
oSIST prEN 18033:2024
prEN 18033:2023 (E)
European foreword
This document (prEN 18033:2023) has been prepared by Technical Committee CEN/TC 460 “Food
Authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to CEN Enquiry.
oSIST prEN 18033:2024
prEN 18033:2023 (E)
Introduction
Food authenticity and integrity are key aspects in terms of consumer protection. In the last three decades,
globalization has taken place in the trade of food. During the last decades, a lot of methods applying PCR
and particularly real-time PCR protocols for the identification of animal species used for food
consumption (e.g. pig, cattle, sheep, horse, chicken, and turkey) have been established.
The European Union (EU) and United Kingdom (UK) horse meat issue in 2013, where a significant amount
of horse DNA was found in a beef burger intended for sale to the public at a supermarket, brought into
perspective that the development of harmonized and standardized protocols for the authentication of
meat products is necessary to establish reliable methods for the detection of potential food fraud.
This standard contains public sector information licensed under the UK Open Government Licence v3.0
(Open Government Licence (nationalarchives.gov.uk))
oSIST prEN 18033:2024
prEN 18033:2023 (E)
1 Scope
This document specifies a real-time PCR procedure for the quantitation of the amount of equine DNA
relative to total mammalian DNA in a raw meat sample.
Results of this equine assay are expressed in terms of equine (Equus genus) haploid genome copy
numbers relative to total mammalian haploid genome copy numbers. This assay is specific for
representatives of the genus Equus and therefore detects horse, mule, donkey and zebra DNA.
The method has been previously validated in a collaborative trial and applied to DNA extracted from
samples that consist of raw horse meat in a raw beef (meat) background.
The limit of detection has been determined experimentally to be at least 9 genomic equivalent copies
(~ 17 haploid target gene copies) for both the horse genome (E. caballus) and mammalian genome (raw
meat samples) based on the lowest dilution on the respective calibration curves through single
laboratory validation. The lowest relative horse content of the target sequence included in the
collaborative trial was a mass fraction of 0,1 % based on gravimetrically prepared raw horse muscle
tissue in a raw beef muscle tissue background.
The compliance assessment process is not part of this document.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) - General requirements and
definitions (ISO 20813)
EN ISO 21571:2005, Foodstuffs — Methods of analysis for the detection of genetically modified organisms
and derived products — Nucleic acid extraction (ISO 21571)
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https://www.iso.org/obp
— IEC Electropedia: available at https://www.electropedia.org/
4 Principle
Test samples containing equine DNA in a background of beef DNA are analysed by a relative quantitation
approach utilizing singleplex real-time PCR assays targeting the equine growth hormone receptor gene
[1] and the myostatin gene [2] present in mammals and poultry. DNA template concentration is
quantified prior to the real-time PCR to normalize test input levels. 100 % horse (E. caballus) DNA derived
from authenticated raw horse meat materials that have been extracted and treated in the same manner
as the test samples are used to generate separate calibration curves for both the equine-specific target
and the mammalian target based on estimated genome equivalents. Test samples are evaluated using the
same equine-specific and universal mammalian qPCR assays. Estimated genome equivalent copy
numbers are determined for the test samples using the equine and mammalian calibration curves. The
oSIST prEN 18033:2024
prEN 18033:2023 (E)
percentage equine DNA content of the test sample is expressed as a ratio of the number of equine haploid
genome equivalents relative to the total mammalian haploid genome equivalents present in the sample.
5 Reagents and materials
5.1 General
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade,
and distilled or demineralized water or water of equivalent purity, according to EN ISO 20813. Regarding
laboratory organization, see EN ISO 20813. Although it is not obligatory to use the reagents,
instrumentation or conditions specified in the standard, when a laboratory chooses not to do so, then it
is the responsibility of that laboratory to validate the results obtained.
5.2 PCR master mix
PCR master mix contains thermostable DNA polymerase, pH buffer, KCl, MgCl , uracil-DNA
glycosylase (UDG), and the four dNTPs (dATP, dCTP, dGTP and dUTP) as a dilutable concentrate, which
1, 2, 3
is ready-to-use .
5.3 Oligonucleotides
The quality of the oligonucleotides shall be sufficient for their use as primers and probes. See Table 1 and
Table 2.
Table 1 — Oligonucleotides for amplification of the equine-specific gene region [1]
Final concentration
Name DNA Sequence of oligonucleotide
in PCR
a
Equine Growth Hormone Receptor gene, GenBank accession number AF392878
EC-GHR1-F
5'-CCAACTTCATCATGGACAACGC-3' 0,2 µM
(Forward primer)
EC-GHR1-R
5'-GTTAAAGCTTGGCTCGACACG-3' 0,2 µM
(Reverse primer)
EC-GHR1_(P)
b
0,2 µM
5'-[FAM]-AAGTGCATCCCCGTGGCCCCTCA-[NFQ] -3'
(Probe)
a
PCR product = 600 - CCAACTTCATCATGGACAACGCCTACTTCTGTGAGGCAGATGCCAAAAAGTGCATCCCCG
TGGCCCCTCACGTCGAGGTTGAATCACGTGTCGAGCCAAGCTTTAAC –706
b
FAM: 6-Carboxy fluorescein, NFQ: Non-fluorescent quencher
1 During the collaborative study 2× TaqMan® Universal PCR Master Mix containing qPCR buffer, hot start Taq polymerase and
ROX passive reference dye was used.
2 The formulation of PCR Master Mix employed must be suitable for use with the make and model of thermocycler employed.
Equivalent products to those specified may be used if they can be demonstrated to lead to the same results.
3 This information is given for the convenience of users of this document and does not constitute an endorsement by CEN of the
products named.
oSIST prEN 18033:2024
prEN 18033:2023 (E)
Table 2 — Oligonucleotides for amplification of the mammalian gene region [2]
Final concentration
Name DNA Sequen
...
Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.