SIST EN 17882:2024
(Main)Food authenticity - DNA barcoding of meat derived from mammals and birds using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
Food authenticity - DNA barcoding of meat derived from mammals and birds using defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
This document describes a procedure for the identification of meat and meat products derived from mammalia and poultry to the level of genus or species.
The identification of meat species is carried out by PCR amplification of either a segment of the mitochondrial cytochrome b gene (cytb) [1] or the cytochrome c oxidase I gene (COI) [2], or both, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases [3], [4]. The methodology allows the identification of a large number of frequently used as well as exotic meat species in foodstuffs.
The decision whether the cytb or COI gene segment or both are used for meat identification depends on the declared meat species, the applicability of the PCR method for the meat species and the availability of comparative sequences in the public databases.
This method has been successfully validated on raw meat, however, laboratory experience is available that it can also be applied to processed meat products.
This document is usually unsuitable for the analysis of highly processed foods with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex meat products containing mixtures of two or more meat species.
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom c Oxidase-I-Gensegmente
Dieses Dokument beschreibt ein Verfahren für die Identifizierung von Fleisch und Fleischerzeugnissen von Säugetieren und Vögeln auf Gattungs- oder Speziesebene.
Die Identifizierung der Fleischspezies erfolgt durch PCR-Amplifikation entweder eines Segments des mitochondrialen Cytochrom-b-Gens (cytb) [1] oder des Cytochrom-c-Oxidase-I-Gens (COI) [2] oder von beiden, gefolgt von der Sequenzierung der PCR-Produkte und einem anschließenden Datenbankabgleich der Sequenzen [3] [4]. Die Vorgehensweise ermöglicht die Identifizierung einer großen Anzahl häufig konsumierter aber auch exotischer Fleischspezies in Lebensmitteln.
Die Entscheidung, ob das cytb- oder das COI-Gensegment oder beide Segmente für die Fleischidentifizierung herangezogen werden, hängt von der deklarierten Fleischspezies, der Anwendbarkeit des PCR-Verfahrens für die Fleischspezies und der Verfügbarkeit vergleichbarer Sequenzen in den öffentlichen Datenbanken ab.
Dieses Verfahren wurde erfolgreich an rohem Fleisch validiert, Laborerfahrungen zeigen jedoch, dass es auch bei verarbeiteten Fleischerzeugnissen angewendet werden kann.
Für die Untersuchung stark verarbeiteter Lebensmittel mit stark degradierter DNA, bei denen die Fragmentlängen nicht für eine Amplifikation der Zielsequenzen ausreichen, ist dieses Dokument in der Regel nicht geeignet. Außerdem ist es nicht anwendbar auf zusammengesetzte Fleischprodukte, die mehr als einer Fleischspezies enthalten.
Authenticité des aliments - Codage à barres de l'ADN de viande dérivée de mammifères et d'oiseaux à l'aide de segments définis du gène du cytochrome b mitochondrial et de la cytochrome c oxydase I
Le présent document décrit un mode opératoire d’identification de la viande et des produits carnés dérivés de mammifères et volailles, au niveau du genre ou de l’espèce.
L’identification de l’espèce de viande est effectuée par amplification PCR d’un segment du gène du cytochrome b mitochondrial (cytb) [1] et/ou du gène de la cytochrome c oxydase I (COI) [2], suivie du séquençage des produits de PCR puis de la comparaison des séquences avec les entrées présentes dans les bases de données [3], [4]. La méthode permet d'identifier un grand nombre d’espèces de viande courantes et exotiques dans les produits alimentaires.
La décision d’utiliser le segment du gène cytb et/ou COI pour identifier la viande dépend de l’espèce de viande déclarée, de l’applicabilité de la méthode PCR vis-à-vis de l’espèce de viande et de la disponibilité des séquences comparatives dans les bases de données publiques.
Cette méthode a été validée avec succès sur la viande crue. Toutefois, les expériences menées en laboratoire montrent qu’elle peut également être appliquée aux produits carnés transformés.
D’une façon générale, le présent document ne convient pas à l’analyse d’aliments hautement transformés contenant de l’ADN fortement dégradé dans lequel les longueurs de fragment ne sont pas suffisantes pour amplifier les cibles. Par ailleurs, il n’est pas applicable aux produits carnés complexes contenant des mélanges d’au moins deux espèces de viande.
Pristnost živil - Črtno kodiranje DNK mesa, pridobljenega iz sesalcev in ptic, z uporabo definiranih mitohondrijskih genskih segmentov citokroma b in citokroma c oksidaze I
Ta dokument opisuje postopek za identifikacijo mesa in mesnih proizvodov, pridobljenih iz sesalcev in perutnine, do stopnje rodu ali vrste.
Identifikacija vrst mesa se izvaja z okrepitvijo polimerazne verižne reakcije (PCR) bodisi segmenta mitohondrijskega gena za citokrom b (cytb) [1] ali gena za citokrom c oksidaze I (COI) [2] ali obojega, čemur sledita sekvenciranje produktov polimerazne verižne reakcije in nadaljnja primerjava sekvenc z vnosi v zbirkah podatkov [3], [4]. Metodologija omogoča identifikacijo velikega števila tako pogosto uporabljenih kot eksotičnih vrst mesa v živilih.
Odločitev o tem, ali se za identifikacijo mesa uporablja genski segment cytb ali COI ali oba, je odvisna od navedene vrste mesa, uporabnosti metode polimerazne verižne reakcije za vrste mesa in razpoložljivosti primerjalnih sekvenc v javnih zbirkah podatkov.
Ta metoda je bila uspešno potrjena pri surovem mesu, vendar jo je mogoče na podlagi rezultatov laboratorijskih preskusov uporabiti tudi za predelane mesne proizvode.
Ta dokument običajno ni primeren za analizo zelo predelanih živil z zelo razgrajeno DNK, pri katerih dolžine delcev ne zadostujejo za povečanje ciljev. Poleg tega se ne uporablja za kompleksne mesne proizvode, ki vsebujejo mešanico dveh ali več vrst mesa.
General Information
Standards Content (Sample)
SLOVENSKI STANDARD
01-september-2024
Pristnost živil - Črtno kodiranje DNK mesa, pridobljenega iz sesalcev in ptic, z
uporabo definiranih mitohondrijskih genskih segmentov citokroma b in citokroma
c oksidaze I
Food authenticity - DNA barcoding of meat derived from mammals and birds using
defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von
Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom
c Oxidase-I-Gensegmente
Authenticité des aliments - Codage à barres de l'ADN de viande dérivée de mammifères
et d'oiseaux à l'aide de segments définis du gène du cytochrome b mitochondrial et de la
cytochrome c oxydase I
Ta slovenski standard je istoveten z: EN 17882:2024
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.10 Meso in mesni proizvodi Meat and meat products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
EN 17882
EUROPEAN STANDARD
NORME EUROPÉENNE
July 2024
EUROPÄISCHE NORM
ICS 07.080; 67.020; 67.120.10
English Version
Food authenticity - DNA barcoding of meat derived from
mammals and birds using defined mitochondrial
cytochrome b and cytochrome c oxidase I gene segments
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von Fleisch
de viande dérivée de mammifères et d'oiseaux à l'aide und Fleischerzeugnissen von Säugetieren und Vögeln
de segments définis du gène du cytochrome b anhand definierter mitochondrialer Cytochrom b und
mitochondrial et de la cytochrome c oxydase I Cytochrom c Oxidase-I-Gensegmente
This European Standard was approved by CEN on 17 June 2024.
CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 17882:2024 E
worldwide for CEN national Members.
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 7
5 Principle . 7
6 Reagents and materials . 7
7 Apparatus . 8
8 Procedure . 8
8.1 Sample preparation . 8
8.2 DNA extraction . 9
8.3 PCR . 9
8.4 Evaluation of PCR products . 10
8.5 Evaluation of the PCR results . 10
9 Sequencing . 11
9.1 Sequencing of PCR products. 11
9.2 Evaluation of sequence data . 11
9.3 Comparison of the sequence with public databases . 12
10 Interpretation of database query results . 14
11 Validation status and performance criteria . 14
12 Test report . 19
Bibliography. 20
European foreword
This document (EN 17882:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by January 2025, and conflicting national standards shall
be withdrawn at the latest by January 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Fraudulent adulteration of meat in food threatens both public safety and commerce. It can affect those
adhering to ethnological dietary rules, economic development and social stability. In the last three
decades, globalization has taken place in the trade of food. Meat trade channels are becoming steadily
longer and more complicated so that sophisticated traceability tools are needed to ensure food safety.
Correct food labelling is a prerequisite to ensure safe meat products and fair trade. The development of
reliable, harmonized and standardized protocols for the authentication of meat and meat products is
necessary to ensure consumer protection and the detection of potential food fraud.
1 Scope
This document specifies a method for the identification of meat derived from mammals and birds to the
level of genus or species and allows the identification of a large number of commercially important as
well as exotic meat species using DNA barcoding.
This method was validated on DNA isolated from single pieces of raw meat. This method can also be used
for the identification of single meat animal species in some processed products.
The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA
where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not
applicable for complex meat products containing mixtures of two or more meat species.
The identification of meat species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both,
followed by sequencing of the PCR products and subsequent sequence comparison with entries in
databases.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions (ISO 20813)
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
sequence alignment
arrangement of nucleic acid sequences or protein sequences according to regions of similarity
Note 1 to entry: The sequence alignment is a process or result of matching up the nucleotide residues of two or
more biological sequences to achieve maximal levels of identity.
[SOURCE: ISO 16577:2022, 3.7.18 – modified, Note 1 to entry added, alternative name added]
3.2
FASTA format
text-based format for representing either nucleotide sequences or amino acid (protein) sequences, in
which nucleotides or amino acids are represented using single-letter codes
Note 1 to entry: A sequence in FASTA format begins with a single-line description, followed by lines of sequence
data. The description line (defline) is distinguished from the sequence data by a greater-than (“>”) symbol at the
beginning.
Note 2 to entry: An example sequence in FASTA format is:
>Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTC
TCAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACAT
TATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAAC
ATACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTA
TTCATAGAGACCTGAAACATTGGAGTTGTACTATTCCTTTTAGTAATAATGACCGCCTTCGTAGGCTACGTCCTCCCT
Note 3 to entry: Blank lines are not allowed in the middle of FASTA input. Sequences are represented in the
standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions:
— lower-case letters are accepted and are mapped into upper-case;
— a single hyphen or dash can be used to represent a gap of indeterminate length.
It is common to end the sequence with an “*” (asterisk) character and to leave a blank line between the description
and the sequence.
[SOURCE: ISO 16577:2022, 3.1.2, modified – Last sentence in Note 1 to entry removed, another example
is used in Note 2 to entry, 3rd bullet point in note 3 to entry deleted]
3.3
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
Note 1 to entry: In the sequence database of Barcode of Life (BOLD), the term similarity is used instead of identity.
3.4
query
sequence (or other type of search term) that is compared to entries in a database
3.5
query coverage
percentage of the query covered by alignment to the data base sequence
3.6
sequence similarity
identity between two or more DNA sequences measured as a percentage
[SOURCE: ISO 16577:2022, 3.7.21]
3.7
specificity
analytical specificity
diagnostic specificity
ability of a detection method to distinguish the specific organism or pathogen from other organisms,
whether related or not, and the extent to which the analysis can distinguish known or unknown variants
of the organism
Note 1 to entry: Specificity is a term that describes the same phenomenon as selectivity but in a different way;
while selectivity is
...
SLOVENSKI STANDARD
01-september-2024
Pristnost živil - Črtno kodiranje DNK mesa, pridobljenega iz sesalcev in ptic, z
uporabo definiranih mitohondrijskih citokroma b in citokroma c oksidaze I genskih
segmentov
Food authenticity - DNA barcoding of meat derived from mammals and birds using
defined mitochondrial cytochrome b and cytochrome c oxidase I gene segments
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von
Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom
c Oxidase-I-Gensegmente
Authenticité des aliments - Codage à barres de l'ADN de viande dérivée de mammifères
et d'oiseaux à l'aide de segments définis du gène du cytochrome b mitochondrial et de la
cytochrome c oxydase I
Ta slovenski standard je istoveten z: EN 17882:2024
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.10 Meso in mesni proizvodi Meat and meat products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
EN 17882
EUROPEAN STANDARD
NORME EUROPÉENNE
July 2024
EUROPÄISCHE NORM
ICS 07.080; 67.020; 67.120.10
English Version
Food authenticity - DNA barcoding of meat derived from
mammals and birds using defined mitochondrial
cytochrome b and cytochrome c oxidase I gene segments
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von Fleisch
de viande dérivée de mammifères et d'oiseaux à l'aide und Fleischerzeugnissen von Säugetieren und Vögeln
de segments définis du gène du cytochrome b anhand definierter mitochondrialer Cytochrom b und
mitochondrial et de la cytochrome c oxydase I Cytochrom c Oxidase-I-Gensegmente
This European Standard was approved by CEN on 17 June 2024.
CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 17882:2024 E
worldwide for CEN national Members.
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 7
5 Principle . 7
6 Reagents and materials . 7
7 Apparatus . 8
8 Procedure . 8
8.1 Sample preparation . 8
8.2 DNA extraction . 9
8.3 PCR . 9
8.4 Evaluation of PCR products . 10
8.5 Evaluation of the PCR results . 10
9 Sequencing . 11
9.1 Sequencing of PCR products. 11
9.2 Evaluation of sequence data . 11
9.3 Comparison of the sequence with public databases . 12
10 Interpretation of database query results . 14
11 Validation status and performance criteria . 14
12 Test report . 19
Bibliography. 20
European foreword
This document (EN 17882:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by January 2025, and conflicting national standards shall
be withdrawn at the latest by January 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Fraudulent adulteration of meat in food threatens both public safety and commerce. It can affect those
adhering to ethnological dietary rules, economic development and social stability. In the last three
decades, globalization has taken place in the trade of food. Meat trade channels are becoming steadily
longer and more complicated so that sophisticated traceability tools are needed to ensure food safety.
Correct food labelling is a prerequisite to ensure safe meat products and fair trade. The development of
reliable, harmonized and standardized protocols for the authentication of meat and meat products is
necessary to ensure consumer protection and the detection of potential food fraud.
1 Scope
This document specifies a method for the identification of meat derived from mammals and birds to the
level of genus or species and allows the identification of a large number of commercially important as
well as exotic meat species using DNA barcoding.
This method was validated on DNA isolated from single pieces of raw meat. This method can also be used
for the identification of single meat animal species in some processed products.
The described method is unsuitable for the analysis of highly processed foods with highly degraded DNA
where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not
applicable for complex meat products containing mixtures of two or more meat species.
The identification of meat species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) or the cytochrome c oxidase I gene (cox1, syn COI) or both,
followed by sequencing of the PCR products and subsequent sequence comparison with entries in
databases.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions (ISO 20813)
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
sequence alignment
arrangement of nucleic acid sequences or protein sequences according to regions of similarity
Note 1 to entry: The sequence alignment is a process or result of matching up the nucleotide residues of two or
more biological sequences to achieve maximal levels of identity.
[SOURCE: ISO 16577:2022, 3.7.18 – modified, Note 1 to entry added, alternative name added]
3.2
FASTA format
text-based format for representing either nucleotide sequences or amino acid (protein) sequences, in
which nucleotides or amino acids are represented using single-letter codes
Note 1 to entry: A sequence in FASTA format begins with a single-line description, followed by lines of sequence
data. The description line (defline) is distinguished from the sequence data by a greater-than (“>”) symbol at the
beginning.
Note 2 to entry: An example sequence in FASTA format is:
>Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTC
TCAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACAT
TATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAAC
ATACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTA
TTCATAGAGACCTGAAACATTGGAGTTGTACTATTCCTTTTAGTAATAATGACCGCCTTCGTAGGCTACGTCCTCCCT
Note 3 to entry: Blank lines are not allowed in the middle of FASTA input. Sequences are represented in the
standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions:
— lower-case letters are accepted and are mapped into upper-case;
— a single hyphen or dash can be used to represent a gap of indeterminate length.
It is common to end the sequence with an “*” (asterisk) character and to leave a blank line between the description
and the sequence.
[SOURCE: ISO 16577:2022, 3.1.2, modified – Last sentence in Note 1 to entry removed, another example
is used in Note 2 to entry, 3rd bullet point in note 3 to entry deleted]
3.3
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
Note 1 to entry: In the sequence database of Barcode of Life (BOLD), the term similarity is used instead of identity.
3.4
query
sequence (or other type of search term) that is compared to entries in a database
3.5
query coverage
percentage of the query covered by alignment to the data base sequence
3.6
sequence similarity
identity between two or more DNA sequences measured as a percentage
[SOURCE: ISO 16577:2022, 3.7.21]
3.7
specificity
analytical specificity
diagnostic specificity
ability of a detection method to distinguish the specific organism or pathogen from other organisms,
whether related or not, and the extent to which the analysis can distinguish known or unknown variants
of the organism
Note 1 to entry: Specificity is a term that describes the same phenomenon as selectivity but in a different way;
while selectivity is
...
Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.