SIST EN 17881:2024
(Main)Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment
Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment
This document describes a procedure for the identification of single bivalves to the level of genus or species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene [1], [2] followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases [5]. The methodology allows the identification of a large number of commercially important bivalve species.
This method has been successfully validated on raw mussels, however, laboratory experience is available that it can also be applied to processed, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, deep-fried samples.
This document is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species.
Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand eines definierten mitochondrialen 16S rRNA‑Genabschnittes
Dieses Dokument beschreibt ein Verfahren für die Identifizierung von einzelnen Muscheln auf Gattungs- oder Speziesebene.
Die Identifizierung der Muschelspezies erfolgt durch PCR-Amplifikation eines Segments des mitochondrialen 16S rRNA-Gens [1] [2], gefolgt von der Sequenzierung der PCR-Produkte und einem anschließenden Daten¬bankabgleich der Sequenzen [5]. Diese Vorgehensweise ermöglicht die Identifizierung einer großen Anzahl kommerziell bedeutender Muschelspezies.
Dieses Verfahren wurde erfolgreich an rohen Muscheln validiert, Laborerfahrungen zeigen jedoch, dass dieses Verfahren auch an verarbeiteten Proben, wie z. B. kalt- und heißgeräucherten, gesalzenen, tiefgefrorenen, gekochten, gebratenen und frittierten Proben, angewendet werden kann.
Für die Untersuchung stark verarbeiteter Lebensmittel, wie z. B. Muschelkonserven mit stark degradierter DNA, bei denen die Fragmentlängen nicht für eine Amplifikation der Zielsequenzen ausreichen, ist dieses Dokument in der Regel nicht geeignet. Außerdem ist es nicht anwendbar auf zusammengesetzte Meeresfrüchteprodukte, die mehr als eine Muschelspezies enthalten.
Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Le présent document décrit un mode opératoire d’identification des bivalves au niveau du genre ou de l’espèce.
L’identification de l’espèce de bivalve est effectuée par amplification PCR d’un segment du gène de l’ARNr 16S mitochondrial [1], [2], suivie du séquençage des produits de PCR puis de la comparaison des séquences avec les entrées présentes dans les bases de données [5]. La méthode permet d'identifier un grand nombre d’espèces de bivalves importantes sur le plan commercial.
Cette méthode a été validée avec succès sur les moules crues. Toutefois, les expériences en laboratoire montrent qu’elle peut également être appliquée aux échantillons transformés, par exemple fumés à froid, fumés à chaud, salés, congelés, cuits, frits, frits dans l’huile.
D’une façon générale, le présent document ne convient pas à l’analyse d’aliments hautement transformés, par exemple les moules en conserve, contenant de l’ADN fortement dégradé dans lequel les longueurs de fragment ne sont pas suffisantes pour amplifier les cibles. Par ailleurs, il n’est pas applicable aux produits complexes à base de fruits de mer contenant des mélanges d’au moins deux espèces de bivalves.
Pristnost živil - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz školjk, z uporabo definiranega mitohondrijskega genskega segmenta 16S rRNA
General Information
Standards Content (Sample)
SLOVENSKI STANDARD
01-september-2024
Pristnost živil - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz školjk, z
uporabo definiranega mitohondrijskega genskega segmenta 16S rRNA
Food authenticity - DNA barcoding of bivalves and products derived from bivalves using
a defined mitochondrial 16S rRNA gene segment
Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand
eines definierten mitochondrialen 16S rRNA‑Genabschnittes
Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de
bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Ta slovenski standard je istoveten z: EN 17881:2024
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.30 Ribe in ribji proizvodi Fish and fishery products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.
EN 17881
EUROPEAN STANDARD
NORME EUROPÉENNE
July 2024
EUROPÄISCHE NORM
ICS 07.080; 67.020; 67.120.30
English Version
Food authenticity - DNA barcoding of bivalves and
products derived from bivalves using a defined
mitochondrial 16S rRNA gene segment
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von
de bivalves et produits dérivés de bivalves à l'aide d'un Muscheln und Muschelprodukten anhand eines
segment défini du gène de l'ARNr 16S mitochondrial definierten mitochondrialen 16S rRNA-Genabschnittes
This European Standard was approved by CEN on 17 June 2024.
CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.
CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION
EUROPÄISCHES KOMITEE FÜR NORMUNG
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 17881:2024 E
worldwide for CEN national Members.
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 7
5 Principle . 7
6 Reagents and materials . 7
7 Apparatus . 8
8 Procedure. 8
8.1 Sample preparation . 8
8.2 DNA extraction . 8
8.3 PCR . 8
8.4 Evaluation of PCR products . 10
8.5 Evaluation of the PCR results . 10
9 Sequencing . 11
9.1 Sequencing of PCR products . 11
9.2 Evaluation of sequence data . 11
9.3 Comparison of the sequence with GenBank® . 11
10 Interpretation of database query results . 12
11 Validation status and performance criteria . 13
12 Test report . 14
Annex A (informative) Practical laboratory data for 16S rRNA barcoding of examplary
bivalve species . 16
Bibliography . 17
European foreword
This document (EN 17881:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by January 2025, and conflicting national standards shall
be withdrawn at the latest by January 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Food safety is a key aspect in terms of consumer protection. In the last three decades, globalization has
taken place in the trade of food. Seafood trade channels are becoming steadily longer and more
complicated so sophisticated traceability tools are needed to ensure food safety. Correct food labelling is
a prerequisite to ensure safe seafood products and fair trade as well as to minimize illegal, unreported,
and unregulated (IUU) fishing. Seafood products are increasingly being processed in export countries.
Especially bivalves are often sold without shells. That makes the identification of species by
morphological characteristics impossible.
The development of harmonized and standardized protocols for the authentication of bivalve products is
necessary to establish reliable methods for the detection of potential food fraud.
1 Scope
This document specifies a method for the taxonomic identification of a single bivalve or piece of bivalve
to the genus or species level using DNA barcoding. It allows the identification of a large number of
commercially important bivalve species.
This method was validated on raw mussels. Laboratory experience indicates additional applicability to
processed bivalve products, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, and deep-fried
samples.
The described method is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels,
with highly degraded DNA where the fragment lengths are not sufficient for amplification of the target.
Furthermore, it is not applicable for complex seafood products containing mixtures of two or more
bivalve species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial
16S rRNA gene, followed by sequencing of the PCR products and subsequent sequence comparison with
entries in databases.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions (ISO 20813)
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
sequence alignment
arrangement of nucleic acid sequences or protein sequences according to regions of similarity
Note 1 to entry: The sequence alignment is a process or result of matching up the nucleotide residues of two or
more biological sequences to achieve maximal levels of identity.
[SOURCE: ISO 16577:2022, 3.7.18 – modified, Note 1 to entry added, alternative name added]
3.2
FASTA format
text-based format for representing either nucleotide sequences or amino acid (protein) sequences, in
which nucleotides or amino acids are represented using single-letter codes
Note 1 to entry: A sequence in FASTA format begins with a single-line description, followed by lines of sequence
data. The description line (defline) is distinguished from the sequence data by a greater-than (“>”) symbol at the
beginning.
Note 2 to entry: An example sequence in FASTA format is:
>Sample_04_16S rRNA gene
ATCACGTAGGATTTTAATGGGCGAACATACCAACCATTGAGACCGCCTACAGCCTCAGGATATCCGGAGCCAACATCGAGG
TCGCAAACTTTCTCATCTATAAGAACTATCAAAGAAAATAACGCTGTTATCCCCGGAGTAACTTCTTCTGTTAATCACTAA
ATAAAGTAAGTGGGTCGTCTATCAAACAAAGAAAAGAAAGAGTCTGATCTTGCTCTTTTGCTGCCCCAGCCAACAACAAAA
GTGGTAAGAATATCTCTGCCACTTAGTTAACAACTTCACGGGGTCTTCTCGTCTATCACTTATATTTAAGCATTTGCACTT
AAAATTCAATTTCATATAATTCAGCTAGAGACAGTTATAGGCTCGTCAATCCATTCACAGGGCCCCCAATTAGAGGGCCAT
AATTTAGCTACCTTAGCACGCTTTACCGCATCCGTTTAAGTCATCTCACTGGGAAGGAACGACCTACTATAAATACAGTAG
GCCATGTTTTT
Note 3 to entry: Blank lines are not allowed in the middle of FASTA input. Sequences are represented in the
standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions:
— lower-case letters are accepted and are mapped into upper-case;
— a single hyphen or dash can be used to represent a gap of indeterminate length.
It is common to end the sequence with an “*” (asterisk) character and to leave a blank line between the description
and the sequence.
[SOURCE: ISO 16577:2022, 3.1.2, modified – Last sentence in Note 1 to entry removed, another example
is used in Note 2 to entry, 3rd bullet point in note 3 to entry deleted]
3.3
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
3.4
introgressed DNA
allele from one species incorporated in the gene pool of another, divergent species
Note 1 to entry: Introgression has usually happened via hybridization and backcrossing of individuals belonging
to different species.
3.5
query
sequence (or other type of search term) that is compared to entries in a database
3.6
query coverage
percentage of the query covered by alignment to the database sequence
3.7
specificity
analytical specificity
diagnostic specificity
ability of a detection method to distinguish the specific organism or pathogen from other organisms,
whether related or not, and the extent to which the analysis can distinguish known or unknown variants
of
...
Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.