General Information

Abstract

This document specifies a method for the taxonomic identification of a single bivalve or piece of bivalve to the genus or species level using DNA barcoding. It allows the identification of a large number of commercially important bivalve species.
This method was validated on raw mussels. Laboratory experience indicates additional applicability to processed bivalve products, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, and deep-fried samples.
The described method is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the target. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.

Status
Published
Publication Date
16-Jul-2024
Technical Committee
CEN/TC 460 - Food Authenticity
Current Stage
6060 - Definitive text made available (DAV) - Publishing
Start Date
17-Jul-2024
Due Date
20-Sep-2023
Completion Date
17-Jul-2024

Buy Documents

Overview

EN 17881:2024 (CEN) defines a standardized DNA barcoding method for the taxonomic identification of single bivalves or single pieces of bivalve products to genus or species level using a defined mitochondrial 16S rRNA gene segment. The method uses PCR amplification (approx. 550 bp target), DNA sequencing (e.g., Sanger), and sequence comparison against reference databases (e.g., GenBank®) to assign species identity. The protocol was validated on raw mussels and is reported to be applicable to many processed bivalve products (cold‑/hot‑smoked, salted, frozen, cooked, fried, deep‑fried), but it is generally unsuitable for highly processed foods with severely degraded DNA (e.g., tins) or for complex mixtures containing two or more bivalve species.

Key topics and technical requirements

  • Analytical principle: PCR amplification of a mitochondrial 16S rRNA fragment → sequencing of PCR product → database sequence comparison and interpretation.
  • Validated scope: Large number of commercially important bivalve species; validated on raw mussels with laboratory evidence for many processed formats.
  • Limitations: Not applicable to highly degraded DNA or mixed‑species seafood products.
  • Procedure elements:
    • Representative sample preparation (avoid surface contaminants; separate individual pieces for processed foods).
    • DNA extraction following EN ISO 21571 guidance; commercial kits allowed if validated for bivalves.
    • PCR reagents and setup (method validated with 25 µl reactions; hot‑start polymerases and commercial master mixes have been used successfully).
    • Sequencing of amplicons with the PCR primers used for amplification and evaluation by sequence alignment and identity metrics.
  • Performance & interpretation: Sequence identity and query coverage against reference databases determine species assignment; Annex A provides practical laboratory examples.
  • Quality: Use molecular biology grade reagents and laboratory organization per EN ISO 20813.

Applications

  • Seafood authentication and traceability: Verify species claims on labels, support supply‑chain transparency, and reduce fraud.
  • Regulatory enforcement: Aid food control authorities in species verification and combating IUU (illegal, unreported, unregulated) fishing.
  • Industry quality control: Shellfish processors, retailers, and certification bodies can apply the method to confirm species integrity of single bivalve pieces.
  • Research and reference labs: Taxonomic studies, reference database curation, and method validation for new products.

Who should use this standard

  • Accredited food testing laboratories
  • National food safety and fisheries authorities
  • Seafood processors, importers and retailers
  • Certification bodies and third‑party auditors
  • Research institutions working on seafood authenticity

Related standards

  • ISO 16577 - Vocabulary for molecular biomarker methods
  • EN ISO 20813 - Nucleic acid‑based methods - general requirements
  • EN ISO 21571 - DNA extraction guidance

Keywords: EN 17881:2024, DNA barcoding, bivalves, 16S rRNA, food authenticity, seafood authentication, PCR, sequencing, CEN, mussel identification.

Relations

Effective Date
25-Aug-2026
Effective Date
28-Jan-2026
Effective Date
28-Jan-2026

Buy Documents

Get Certified

Connect with accredited certification bodies for this standard

BSI Group

BSI (British Standards Institution) is the business standards company that helps organizations make excellence a habit.

UKAS United Kingdom Verified

Bureau Veritas

Bureau Veritas is a world leader in laboratory testing, inspection and certification services.

COFRAC France Verified

DNV

DNV is an independent assurance and risk management provider.

NA Norway Verified

Sponsored listings

Frequently Asked Questions

EN 17881:2024 is a standard published by the European Committee for Standardization (CEN). Its full title is "Food authenticity - DNA barcoding of bivalves and products derived from bivalves using a defined mitochondrial 16S rRNA gene segment". This standard covers: This document specifies a method for the taxonomic identification of a single bivalve or piece of bivalve to the genus or species level using DNA barcoding. It allows the identification of a large number of commercially important bivalve species. This method was validated on raw mussels. Laboratory experience indicates additional applicability to processed bivalve products, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, and deep-fried samples. The described method is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the target. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species. The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.

This document specifies a method for the taxonomic identification of a single bivalve or piece of bivalve to the genus or species level using DNA barcoding. It allows the identification of a large number of commercially important bivalve species. This method was validated on raw mussels. Laboratory experience indicates additional applicability to processed bivalve products, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, and deep-fried samples. The described method is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels, with highly degraded DNA where the fragment lengths are not sufficient for amplification of the target. Furthermore, it is not applicable for complex seafood products containing mixtures of two or more bivalve species. The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial 16S rRNA gene, followed by sequencing of the PCR products and subsequent sequence comparison with entries in databases.

EN 17881:2024 is classified under the following ICS (International Classification for Standards) categories: 07.080 - Biology. Botany. Zoology; 67.020 - Processes in the food industry; 67.120.30 - Fish and fishery products. The ICS classification helps identify the subject area and facilitates finding related standards.

EN 17881:2024 has the following relationships with other standards: It is inter standard links to ISO 16577:2022, EN ISO 20813:2022, FprEN 890. Understanding these relationships helps ensure you are using the most current and applicable version of the standard.

EN 17881:2024 is associated with the following European legislation: EU Directives/Regulations: 2017/625, 882/2004. When a standard is cited in the Official Journal of the European Union, products manufactured in conformity with it benefit from a presumption of conformity with the essential requirements of the corresponding EU directive or regulation.

EN 17881:2024 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.

Standards Content (Sample)


SLOVENSKI STANDARD
01-september-2024
Pristnost živil - Črtno kodiranje DNK školjk in proizvodov, pridobljenih iz školjk, z
uporabo definiranega mitohondrijskega genskega segmenta 16S rRNA
Food authenticity - DNA barcoding of bivalves and products derived from bivalves using
a defined mitochondrial 16S rRNA gene segment
Lebensmittelauthentizität - DNA-Barcoding von Muscheln und Muschelprodukten anhand
eines definierten mitochondrialen 16S rRNA‑Genabschnittes
Authenticité des aliments - Codage à barres de l’ADN de bivalves et produits dérivés de
bivalves à l’aide d’un segment défini du gène de l’ARNr 16S mitochondrial
Ta slovenski standard je istoveten z: EN 17881:2024
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.30 Ribe in ribji proizvodi Fish and fishery products
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

EN 17881
EUROPEAN STANDARD
NORME EUROPÉENNE
July 2024
EUROPÄISCHE NORM
ICS 07.080; 67.020; 67.120.30
English Version
Food authenticity - DNA barcoding of bivalves and
products derived from bivalves using a defined
mitochondrial 16S rRNA gene segment
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von
de bivalves et produits dérivés de bivalves à l'aide d'un Muscheln und Muschelprodukten anhand eines
segment défini du gène de l'ARNr 16S mitochondrial definierten mitochondrialen 16S rRNA-Genabschnittes
This European Standard was approved by CEN on 17 June 2024.

CEN members are bound to comply with the CEN/CENELEC Internal Regulations which stipulate the conditions for giving this
European Standard the status of a national standard without any alteration. Up-to-date lists and bibliographical references
concerning such national standards may be obtained on application to the CEN-CENELEC Management Centre or to any CEN
member.
This European Standard exists in three official versions (English, French, German). A version in any other language made by
translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC Management
Centre has the same status as the official versions.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION

EUROPÄISCHES KOMITEE FÜR NORMUNG

CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2024 CEN All rights of exploitation in any form and by any means reserved Ref. No. EN 17881:2024 E
worldwide for CEN national Members.

Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Symbols and abbreviations . 7
5 Principle . 7
6 Reagents and materials . 7
7 Apparatus . 8
8 Procedure. 8
8.1 Sample preparation . 8
8.2 DNA extraction . 8
8.3 PCR . 8
8.4 Evaluation of PCR products . 10
8.5 Evaluation of the PCR results . 10
9 Sequencing . 11
9.1 Sequencing of PCR products . 11
9.2 Evaluation of sequence data . 11
9.3 Comparison of the sequence with GenBank® . 11
10 Interpretation of database query results . 12
11 Validation status and performance criteria . 13
12 Test report . 14
Annex A (informative) Practical laboratory data for 16S rRNA barcoding of examplary
bivalve species . 16
Bibliography . 17
European foreword
This document (EN 17881:2024) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This European Standard shall be given the status of a national standard, either by publication of an
identical text or by endorsement, at the latest by January 2025, and conflicting national standards shall
be withdrawn at the latest by January 2025.
Attention is drawn to the possibility that some of the elements of this document may be the subject of
patent rights. CEN shall not be held responsible for identifying any or all such patent rights.
Any feedback and questions on this document should be directed to the users’ national standards body.
A complete listing of these bodies can be found on the CEN website.
According to the CEN-CENELEC Internal Regulations, the national standards organisations of the
following countries are bound to implement this European Standard: Austria, Belgium, Bulgaria, Croatia,
Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Iceland, Ireland,
Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway, Poland, Portugal, Republic of North
Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and the United
Kingdom.
Introduction
Food safety is a key aspect in terms of consumer protection. In the last three decades, globalization has
taken place in the trade of food. Seafood trade channels are becoming steadily longer and more
complicated so sophisticated traceability tools are needed to ensure food safety. Correct food labelling is
a prerequisite to ensure safe seafood products and fair trade as well as to minimize illegal, unreported,
and unregulated (IUU) fishing. Seafood products are increasingly being processed in export countries.
Especially bivalves are often sold without shells. That makes the identification of species by
morphological characteristics impossible.
The development of harmonized and standardized protocols for the authentication of bivalve products is
necessary to establish reliable methods for the detection of potential food fraud.
1 Scope
This document specifies a method for the taxonomic identification of a single bivalve or piece of bivalve
to the genus or species level using DNA barcoding. It allows the identification of a large number of
commercially important bivalve species.
This method was validated on raw mussels. Laboratory experience indicates additional applicability to
processed bivalve products, e.g. cold smoked, hot smoked, salted, frozen, cooked, fried, and deep-fried
samples.
The described method is usually unsuitable for the analysis of highly processed foods, e.g. tins of mussels,
with highly degraded DNA where the fragment lengths are not sufficient for amplification of the target.
Furthermore, it is not applicable for complex seafood products containing mixtures of two or more
bivalve species.
The identification of bivalve species is carried out by PCR amplification of a segment of the mitochondrial
16S rRNA gene, followed by sequencing of the PCR products and subsequent sequence comparison with
entries in databases.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
EN ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions (ISO 20813)
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
sequence alignment
arrangement of nucleic acid sequences or protein sequences according to regions of similarity
Note 1 to entry: The sequence alignment is a process or result of matching up the nucleotide residues of two or
more biological sequences to achieve maximal levels of identity.
[SOURCE: ISO 16577:2022, 3.7.18 – modified, Note 1 to entry added, alternative name added]
3.2
FASTA format
text-based format for representing either nucleotide sequences or amino acid (protein) sequences, in
which nucleotides or amino acids are represented using single-letter codes
Note 1 to entry: A sequence in FASTA format begins with a single-line description, followed by lines of sequence
data. The description line (defline) is distinguished from the sequence data by a greater-than (“>”) symbol at the
beginning.
Note 2 to entry: An example sequence in FASTA format is:
>Sample_04_16S rRNA gene
ATCACGTAGGATTTTAATGGGCGAACATACCAACCATTGAGACCGCCTACAGCCTCAGGATATCCGGAGCCAACATCGAGG
TCGCAAACTTTCTCATCTATAAGAACTATCAAAGAAAATAACGCTGTTATCCCCGGAGTAACTTCTTCTGTTAATCACTAA
ATAAAGTAAGTGGGTCGTCTATCAAACAAAGAAAAGAAAGAGTCTGATCTTGCTCTTTTGCTGCCCCAGCCAACAACAAAA
GTGGTAAGAATATCTCTGCCACTTAGTTAACAACTTCACGGGGTCTTCTCGTCTATCACTTATATTTAAGCATTTGCACTT
AAAATTCAATTTCATATAATTCAGCTAGAGACAGTTATAGGCTCGTCAATCCATTCACAGGGCCCCCAATTAGAGGGCCAT
AATTTAGCTACCTTAGCACGCTTTACCGCATCCGTTTAAGTCATCTCACTGGGAAGGAACGACCTACTATAAATACAGTAG
GCCATGTTTTT
Note 3 to entry: Blank lines are not allowed in the middle of FASTA input. Sequences are represented in the
standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions:
— lower-case letters are accepted and are mapped into upper-case;
— a single hyphen or dash can be used to represent a gap of indeterminate length.
It is common to end the sequence with an “*” (asterisk) character and to leave a blank line between the description
and the sequence.
[SOURCE: ISO 16577:2022, 3.1.2, modified – Last sentence in Note 1 to entry removed, another example
is used in Note 2 to entry, 3rd bullet point in note 3 to entry deleted]
3.3
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
3.4
introgressed DNA
allele from one species incorporated in the gene pool of another, divergent species
Note 1 to entry: Introgression has usually happened via hybridization and backcrossing of individuals belonging
to different species.
3.5
query
sequence (or other type of search term) that is compared to entries in a database
3.6
query coverage
percentage of the query covered by alignment to the database sequence
3.7
specificity
analytical specificity
diagnostic specificity
ability of a detection method to distinguish the specific organism or pathogen from other organisms,
whether related or not, and the extent to which the analysis can distinguish known or unknown variants
of the organism
Note 1 to entry: Specificity is a term that describes the same phenomenon as selectivity but in a different way;
while selectivity is applied to analytical chemistry and physics, specificity is applied to organisms and pathogens.
[SOURCE: ISO 16577:2022, 3.3.76]
4 Symbols and abbreviations
bp base pairs
dNTP deoxyribonucleotide triphosphate
DNA deoxyribonucleic acid
IUU illegal, unreported, and unregulated
PCR polymerase chain reaction
rRNA ribosomal ribonucleic acid
RNA ribonucleic acid
A adenine
C cytosine
G guanine
T thymine
5 Principle
DNA is extracted from a bivalve or bivalve product applying a suitable method. A segment of
approximately 550 bp of the 16S rRNA gene is amplified by PCR. The nucleotide sequence of the PCR
product is determined by a suitable DNA sequencing method, e.g. Sanger sequencing. The two PCR
primers used to generate the 16S rRNA amplicon are also used for sequencing. The determined sequence
is evaluated by comparison to sequence entries in databases, thus allowing the assignment to a bivalve
species or genus according to the degree of identity with the available sequences.
Practical laboratory data for 16S rRNA barcoding of exemplary bivalve species can be found in Annex A.
6 Reagents and materials
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled, demineralized or water of equivalent purity, according to EN ISO 20813. Laboratory
organization shall follow EN ISO 20813.
6.1 Thermostable DNA polymerase.
6.2 PCR reaction buffer (including MgCl or with separate MgCl solution).
2 2
6.3 dNTP mix (dATP, dCTP, dGTP and dTTP).

During the collaborative study the laboratories used DNA polymerases and master mixes of different commercial
providers. The amplification of target DNA sequences was successfully obtained with all used master mixes and
DNA polymerases. Hot start DNA polymerases are the preferred option.
dNTPs can also be part of a commercial PCR master mix.
6.4 Oligonucleotides, see Table 1.
[1, 2]
Table 1 — Oligonucleotides for amplification of the 16S rRNA gene region.
Name DNA Sequence of oligonucleotide
16SAR 5'-CGC CTG TTT ATC AAA AAC AT-3'
16SBR 5'-CCG GTC TGA ACT CAG ATC ACG T-3'
6.5 Agarose.
6.6 DNA size standard.
7 Apparatus
In addition to standard laboratory equipment, the following apparatus should be used.
7.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA.
7.2 Thermocycler.
7.3 Gel electrophoresis device.
7.4 Gel documentation system.
7.5 DNA sequencer.
8 Procedure
8.1 Sample preparation
The test portion used for DNA extraction shall be representative of the laboratory sample. In samples that
consist of processed materials (e.g. convenience foods), single bivalve pieces shall be separated and
analysed. For the analysis of samples composed of several pieces (e.g. bags with different bivalves), test
portions for every putative bivalve species are taken and analysed separately. To minimize the risk of
amplifying adhering contaminants, test sample material shall not be taken from the surface of the
laboratory sample, see also EN ISO 20813.
8.2 DNA extraction
[11]
General instructions and measures described in EN ISO 21571 should be followed for the extraction
of DNA from the test sample. For example, the DNA extraction methods described in EN iSO 21571:2005,
[5]
Annex A , can be used. Commercial kits can be used for the extraction and purification of DNA, if their
applicability for the extraction of DNA from bivalves has been experimentally confirmed.
8.3 PCR
8.3.1 General
The primers used for the amplification of the segment from the mitochondrial 16S rRNA gene are
[1,3]
universal primers that not only amplify DNA from bivalves but also from a range of other taxa . The
[3]
primers have been tested against a range of bivalve species .
8.3.2 PCR setup
The method was validated for a total volume of 25 µl per PCR. The reagents given in Table 2 shall be used
for the 16S rRNA PCR.
Reagents shall be thawed completely and centrifuged briefly before usage. A PCR reagent mixture is
prepared containing all PCR components in the given concentrations except for the DNA extract or the
controls. The amount of PCR mixture prepared depends on the total volume per PCR and the total number
of reactions including a sufficient pipetting reserve.
Positive PCR results are expected when using a DNA concentration of approximately 1 ng DNA per μl of
the final reaction solution (25 ng total DNA).
To improve the PCR result the DNA quantity can be increased (e.g. to increase the yield of PCR product)
or decreased (e.g. to avoid PCR inhibition).
Table 2 — Components for the 16S rRNA gene PCR
Reagent (stock solution) Final composition in the reaction solution
PCR buffer 1 x
a
1,5 mmol/l
MgCl
a
0,2 mmol/l for each dNTP
dNTP mix
Primer 16SAR 400 nmol/l
Primer 16SBR 400 nmol/l
Thermostable DNA 0,5 units to 1
...