FprCEN/TS 17883

Environmental characterization of leachates from waste and soil using reproductive and toxicological gene expression in Daphnia magna

This document specifies the crucial steps of a quantitative real-time polymerase chain reaction (qPCR) method to quantify the abundance of specific mRNA molecules extracted from Daphnia magna.
The method allows the identification of molecular responses to exposures for potentially toxic substances through the analysis of the abundance of specific mRNA molecules. In this document, the central genes involved in reproductive and toxic responses are included.
NOTE   The selection of genes can be adapted to specific exposure conditions, for example, exposure to known toxic substances, by adding genes known to respond to a specific insult.
The present method allows for rapid, robust and sensitive detection of molecular responses and can be used to analyse the toxic effects of water leachates from soil and waste. The method gives information of the concentration of a substance or test-liquid at which toxic effects begin to occur prior to observations of reproductive or toxic effects at higher levels of organization, which reduces the need for the use of safety factors in toxicity assessment.
The method is useful in several types of risk assessment. In this document, the genes studied are appropriate for the assessment of the risks when recycling materials and for the classification of waste, but the method can be adapted to other types of risk assessment by including other genes.

Umwelttechnische Charakterisierung von Sickerwässern aus Abfall und Boden mittels reproduktiver und toxikologischer Genexpression in Daphnia magna

Caractérisation environnementale des lixiviats de déchets et de sols à l’aide de l’expression génétique reproductive et toxicologique chez Daphnia magna

Le présent document spécifie les étapes cruciales d’une méthode de réaction de polymérisation en chaîne (qPCR) quantitative en temps réel pour quantifier l’abondance de molécules d’ARNm spécifiques extraites de Daphnia magna.
La méthode permet d’identifier les réponses moléculaires aux expositions à des substances potentiellement toxiques par l’analyse de l’abondance de molécules d’ARNm spécifiques. Dans le présent document, les gènes principaux impliqués dans les réponses reproductives et toxiques sont inclus.
NOTE   La sélection de gènes peut être adaptée à des conditions d’exposition spécifiques, par exemple l’exposition à des substances toxiques connues, en ajoutant des gènes connus pour répondre à une agression spécifique.
La présente méthode permet une détection rapide, fiable et sensible des réponses moléculaires et peut être utilisée pour analyser les effets toxiques des lixiviats des sols et des déchets ainsi que ceux des eaux réceptrices. La méthode donne des informations sur la concentration d’une substance ou d’un liquide d’essai à laquelle les effets toxiques commencent à se manifester avant l’observation d’effets reproductifs ou toxiques à des niveaux d’organisation plus élevés, ce qui réduit la nécessité d’utiliser des facteurs de sécurité dans l’évaluation de la toxicité.
La présente méthode est utile dans plusieurs types d’évaluation du risque. Dans le présent document, les gènes étudiés sont appropriés pour l’évaluation du risque lors du recyclage des matériaux et pour la classification des déchets, mais la méthode peut être adaptée à d’autres types d’évaluation en incluant d’autres gènes.

Okoljska karakterizacija izcednih voda iz odpadkov in tal z reproduktivno in toksikološko ekspresijo genov pri Daphnia magna

General Information

• Status: Not Published
• ICS: 13.030.01 - Wastes in general
• ICS: 13.060.70 - Examination of biological properties of water
• ICS: 13.080.99 - Other standards related to soil quality
• Technical Committee: CEN/TC 444 - Environmental characterization
• Drafting Committee: CEN/TC 444/WG 4 - Biological characterization
• Ref Project: kSIST-TS FprCEN/TS 17883:2022 - Environmental characterization of leachates from waste and soil using reproductive and toxicological gene expression in Daphnia magna

Standards Content (sample)

SLOVENSKI STANDARD
kSIST-TS FprCEN/TS 17883:2022
01-september-2022
Okoljska karakterizacija izcednih voda iz odpadkov in tal z reproduktivno in
toksikološko ekspresijo genov pri Daphnia magna

Environmental characterization of leachates from waste and soil using reproductive and

toxicological gene expression in Daphnia magna

Umwelttechnische Charakterisierung von Sickerwässern aus Abfall und Boden mittels

reproduktiver und toxikologischer Genexpression in Daphnia magna
Ta slovenski standard je istoveten z: FprCEN/TS 17883
ICS:
13.030.01 Odpadki na splošno Wastes in general
13.060.70 Preiskava bioloških lastnosti Examination of biological
vode properties of water
13.080.99 Drugi standardi v zvezi s Other standards related to
kakovostjo tal soil quality
kSIST-TS FprCEN/TS 17883:2022 en,fr,de

2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

---------------------- Page: 1 ----------------------
kSIST-TS FprCEN/TS 17883:2022
---------------------- Page: 2 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FINAL DRAFT
TECHNICAL SPECIFICATION
FprCEN/TS 17883
SPÉCIFICATION TECHNIQUE
TECHNISCHE SPEZIFIKATION
July 2022
ICS 13.030.01; 13.060.70; 13.080.99
English Version
Environmental characterization of leachates from waste
and soil using reproductive and toxicological gene
expression in Daphnia magna

This draft Technical Specification is submitted to CEN members for Vote. It has been drawn up by the Technical Committee

CEN/TC 444.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,

Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,

Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and

United Kingdom.

Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are

aware and to provide supporting documentation.

Warning : This document is not a Technical Specification. It is distributed for review and comments. It is subject to change

without notice and shall not be referred to as a Technical Specification.
EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATIO N
EUROPÄISCHES KOMITEE FÜR NORMUN G
CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels

© 2022 CEN All rights of exploitation in any form and by any means reserved Ref. No. FprCEN/TS 17883:2022 E

worldwide for CEN national Members.
---------------------- Page: 3 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
Contents Page

European foreword ............................................................................................................................................ 3

Introduction .......................................................................................................................................................... 4

1 Scope .......................................................................................................................................................... 9

2 Normative references .......................................................................................................................... 9

3 Terms and definitions ......................................................................................................................... 9

4 Principle ................................................................................................................................................. 10

4.1 General.................................................................................................................................................... 10

4.2 Toxicogenomic qPCR method ......................................................................................................... 11

4.3 Exposure of Daphnia magna ........................................................................................................... 11

4.4 Choice of genes for study .................................................................................................................. 12

5 Test materials ...................................................................................................................................... 13

5.1 Daphnia magna reference water ................................................................................................... 13

5.2 Daphnia magna culture .................................................................................................................... 14

5.3 Reagents ................................................................................................................................................. 14

6 Apparatus .............................................................................................................................................. 14

7 Procedure .............................................................................................................................................. 15

7.1 Leaching ................................................................................................................................................. 15

7.2 Protocol for exposure of the water flea Daphnia magna ...................................................... 15

7.3 Daphnia magna sampling for gene expression analysis ....................................................... 16

7.4 RNA extraction ..................................................................................................................................... 16

7.5 DNA synthesis ....................................................................................................................................... 17

7.6 qPCR procedure ................................................................................................................................... 18

7.7 Analysis of results ............................................................................................................................... 19

7.8 Interpretation of results ................................................................................................................... 19

Annex A (informative) Presentation and interpretation of toxicogenomic data ........................ 21

Bibliography ....................................................................................................................................................... 24

---------------------- Page: 4 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
European foreword

This document (FprCEN/TS 17783:2022) has been prepared by Technical Committee CEN/TC 444

“Environmental characterization of solid matrices”, the secretariat of which is held by NEN.

This document is currently submitted to the Vote on TS.
---------------------- Page: 5 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
Introduction

The aim of this document is to describe the procedure used to set up and perform quantitative PCR to

quantify effects of leachates from waste and soil on reproductive and toxicological endpoints in Daphnia

magna. The presented method allows for rapid, robust and sensitive detection of molecular responses

and can be used to analyse the toxic effects of water leachates from soil and waste as well as the recipient

waters.

The study of messenger RNA (mRNA) from different living organisms, using different molecular

approaches, can be used to identify the responses of organisms to exposure to toxic substances.

Messenger RNA (mRNA) transfers information from the DNA, which stores all the necessary information

needed for life, to the cellular machinery that synthesizes proteins. Proteins are the working units in the

cell and their abundance is highly dependent on the RNA levels in the cell as all proteins are translation

products of mRNA. As mRNA is the first step in the response to toxic substances it is also a quick, precise

and sensitive biomarker of exposure that gives information on the mechanisms responsible for the

responses. The relationship between physiological impact and mechanistic resolution is shown in

Figure 1.

Figure 1 — Differences in physiological impact and mechanistic resolution at different

organizational levels

There is an important difference between determining an effect of a toxic substance and understanding

what it is that cause the effect. Effects that cause harm to entire ecosystems are usually identified by

changes in populations. Effects at the organism/individual level are easiest observed by changes in the

physiology, morphology or behaviour of an organism. However, as the environment is highly complex

and highly variable, the measurement of changes in ecosystems, population or individuals has very low

resolution when it comes to identifying the cause of any observed effect. To avoid “guilt by association”

it is important to identify the connection between an exposure and the observed effect. The most sensitive

methods for this are at the level of RNA and protein regulation at the cellular level. RNA forms the link

between proteins and chromosomal DNA (genes). The chromosomally located genes can be regulated in

several different ways, but independent of the regulatory mechanism, exposure to toxic substances will

result in a change in active RNA and thereby in the corresponding protein.
---------------------- Page: 6 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)

A toxic response is initiated by a molecular initiating event (MIE). This can be the exposure to an inorganic

or organic compound as well as to radioactivity. The MIE is followed by the molecular interaction

between the compound initiating the MIE and a molecule (receptor activation, protein binding, DNA

binding) that results in alterations in a set of key events (KE) starting with changes in gene expression

leading to changes in protein production. This in turn leads to an altered signal cascade that can, if it

overrides homoeostatic control, result in altered functions of cells, tissues and organs. These alterations

in function can then lead to adverse outcomes (AO) such as a malformation, organ dysfunction and

eventually lethality. This results in an AO of regulatory relevance for risk assessment that represents

overt adversity at either organism or population level (Figure 2).
Figure 2 — The Adverse Outcome Pathway

An AOP (Adverse Outcome Pathway), starts with a molecular interaction between a chemical and a

molecule. This step is called the Molecular Initiating Event (MIE). This is followed by a set of Key Events

(KE) propagating the signal to higher levels of organization. This leads to an outcome on the physiology

of an organism and if this outcome is deleterious it is called and Adverse Outcome (AO). The complete

chain of events is therefore called AO Pathway (AOP) and connects the initial exposure, through a

molecular interaction to a physiological change in the organism. At sufficient concentrations of the

chemical and durations of exposure, a KE can increase to a level where it will trigger another KE to shut

down, overcoming cell defence mechanisms and adaptation processes.

Thus, in order for an AO to occur, there has to be an initial molecular interaction leading to alterations in

gene activity. While the AO is the measure of the damage/toxicity of the exposure, the initial changes in

gene activity is the direct response to the exposure.

With the toxicogenomic qPCR method it is possible to directly measure the first KE in the cascade leading

from MIE to AO. This can be done by analysis of genes belonging to selected AOP such as metal toxicity,

xenobiotic toxicity, stress response, reproduction, metabolism, respiration, cell cycle (cancer and

apoptosis). By determining the correlation between significant changes in gene expression and specific

AOPs it is thereby possible to identify the causative factor. Lack of correlation between an AOP and its

MIE indicates that there is no effect caused by the exposure on that AOP. An advantage with this method

is that it allows for identification of the cause of the AO as each gene is regulated by a specific set of

receptors and transcription factors.
---------------------- Page: 7 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)

Analysis of RNA levels is therefore the most robust and sensitive way to determine the mechanism

leading to the effects observed following an exposure. For comparison, reproduction in Daphnia magna

can be analysed by measuring the number of offspring in a 21-day assay. If there is a reduction, or

increase, in offspring this indicates that the exposure affects reproduction. At the same time, a short

exposure (24 h to 96 h) followed by analysis of RNA levels will be able to show if there is a change in the

machinery necessary for reproduction.

One advantage of analysing the regulation of genes is that the induction or reduction in RNA is directly

correlated to specific compounds that can regulate the gene expression. Thus, by combining the analysis

of reproductive RNA with the analysis of RNA measuring toxicity it is possible to determine what type of

toxic effect is caused by the compounds that the organism is exposed to. By analysing the RNA regulation,

it is therefore possible to determine effects related to both HP10 (Toxic for reproduction) and HP14

(Ecotoxic, i.e. causing toxicity to organisms in the environment).

While young daphnids (24 h to 48 h old) can be used to investigate the expression of genes related to

biological pathways activated during early development of the animal (i.e.; metal response, oxidative

stress), older daphnids (>72 h old) are required to analyse effects of the tested compound on genes

related to pathways that are functional in later life stages, such as reproduction. To cover genes involved

in both development, toxicity, and reproduction it is therefore important to expose the animals from

hatching/birth to 96 h.

The analyses can be designed based on previous chemical data indicating what type of exposure that the

Daphnia magna will be experiencing. The resolution of the assay can be increased by selecting specific

genes that are known to respond to specific insults. In addition, by using controlled exposures to specific

compounds it is possible to identify if these are contributing to a measured biological effect see Figure 3.

Thus, it is possible to determine if the effect is caused by a compound of concern or by normally occurring

abiotic properties of the exposure solution.
---------------------- Page: 8 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)

Figure 3 — Testing the effect of identified contaminants in waste, soils or water

The rational for choosing Daphnia magna for toxicological analyses is that it is a sensitive organism.

Daphnia magna is considered a keystone species for the analysis of effects caused by complex

environmental exposure [3]. It has successfully been applied as a sensitive model system for studies of

effects caused by building material and bottom-ash [4,5].
The advantages of the method can be summarized as:

1. Robust: Analysis at the RNA level using qPCR is a robust method. An exposure that affects an animal

has to involve bioavailable compounds that can activate or inhibit the conversion of DNA information

into RNA. This gives information on the responses to the exposure.

2. Quantitative: Analysis at the RNA level is quantifiable. As the amount of RNA is directly proportional

to the activation of genes and occurs rapidly following an exposure this is an easily quantifiable

method.

3. Mechanistic: The resolution of qPCR arrays (including many genes) allows for identification of the

cause leading to the effect. This cannot be achieved by traditional methods at the individual or higher

organizational level.
---------------------- Page: 9 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)

4. Sensitive: Alterations at the RNA level is more sensitive than analysis of physiological, morphological

or behavioural effects at the level of individual organisms or higher. This is due to alterations in RNA

being the first step in the organismal responses to exposure.

5. Complex mixtures: Using the biological qPCR approach allows for the detection of effects, even if they

are caused by complex mixtures, where several compounds in low doses are functioning in an

additive, synergistic or antagonistic manner.

6. Other advantages: The method is less prone to false positives (or negatives). The method is fast. The

method is relatively cheaper than corresponding physiological assays that require longer time and

thus more man hours to perform.
---------------------- Page: 10 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
1 Scope

This document specifies the crucial steps of a quantitative real-time polymerase chain reaction (qPCR)

method to quantify the abundance of specific mRNA molecules extracted from Daphnia magna.

The method allows the identification of molecular responses to exposures for potentially toxic substances

through the analysis of the abundance of specific mRNA molecules. In this document, the central genes

involved in reproductive and toxic responses are included.

NOTE The selection of genes can be adapted to specific exposure conditions, for example, exposure to known

toxic substances, by adding genes known to respond to a specific insult.

The present method allows for rapid, robust and sensitive detection of molecular responses and can be

used to analyse the toxic effects of water leachates from soil and waste. The method gives information of

the concentration of a substance or test-liquid at which toxic effects begin to occur prior to observations

of reproductive or toxic effects at higher levels of organization, which reduces the need for the use of

safety factors in toxicity assessment.

The method is useful in several types of risk assessment. In this document, the genes studied are

appropriate for the assessment of the risks when recycling materials and for the classification of waste,

but the method can be adapted to other types of risk assessment by including other genes.

2 Normative references

The following documents are referred to in the text in such a way that some or all of their content

constitutes requirements of this document. For dated references, only the edition cited applies. For

undated references, the latest edition of the referenced document (including any amendments) applies.

EN 12457-2, Characterization of waste — Leaching — Compliance test for leaching of granular waste

materials and sludges — Part 2: One stage batch test at a liquid to solid ratio of 10 l/kg for materials with

particle size below 4 mm (without or with size reduction)

EN ISO 21268-2, Soil quality — Leaching procedures for subsequent chemical and ecotoxicological testing

of soil and soil-like material — Part 2: Batch test using a liquid to solid ratio of 10 l/kg dry matter

(ISO 21268-2)

ISO 20395, Biotechnology — Requirements for evaluating the performance of quantification methods for

nucleic acid target sequences — qPCR and dPCR
3 Terms and definitions
For the purposes of this document, the following terms and definitions apply.

ISO and IEC maintain terminological databases for use in standardization at the following addresses:

— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
cDNA
conversion product from mRNA
3.2
cycle threshold

number of cycles required for the signal to cross the threshold above the base line

---------------------- Page: 11 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
3.3
dsDNA
double stranded DNA
3.4
mRNA
messenger ribonucleic acid extracted from Daphnia magna
3.5
NOAEL
No Observed Adverse Level
3.6
polymerase chain reaction

method allowing the amplification of a specific DNA sequence using a specific pair of oligonucleotide

primers
3.7
primer

short single stranded DNA sequence used to amplify cDNA or genes in a PCR reaction

3.8
quantitative polymerase chain reaction
qPCR

method allowing quantification of a DNA template (3.12) of the number of a specific cDNA sequence using

a specific pair of oligonucleotide primers
3.9
reverse transcriptase
enzyme that catalyses the formation of DNA from an RNA template
3.10
RNase

enzyme which promotes the breakdown of RNA into oligonucleotides and smaller molecules

3.11
SYBR green
nucleic acid stain used in molecular biology
3.12
template
cDNA sample used to perform PCR (3.6) to amplify a specific DNA sequence
3.13
toxicogenomic
application of omics technology to study toxicity
4 Principle
4.1 General

This document describes a toxicogenomic qPCR method using quantification of specific genes from a gene

panel consisting of genes involved in reproduction and in toxic responses of Daphnia magna.

---------------------- Page: 12 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
4.2 Toxicogenomic qPCR method

The toxicogenomic qPCR method fills the gap that exists between chemical and biological methods of risk

assessment. The method that is based on proven PCR technology for the analysis of effects on gene

expression by different treatments. An increased gene expression leads to increased protein production,

often to restore the balance in the system.

The main tasks to isolate and determine the abundance of specific RNA, following conversion of mRNA to

cDNA, by qPCR are shown in Figure 4.

Figure 4 — Main tasks to determine the abundance of specific RNA by qPCR. A) Exposure of the

Daphnia magna to the test solution B) Extraction of mRNA, cDNA synthesis and qPCR

4.3 Exposure of Daphnia magna

Prior to PCR an acute mortality curve needs to be established and the qPCR should be performed at the

concentration where no more lethality is registered (NOAEL). In order to include reproductive genes in

the panel it is important that the Daphnia magna are exposed following the activation of reproductive

processes that occur 3 days after birth. Therefore, exposure shall be initiated 3 days after hatching/birth

and proceed for 24 h. Following exposure of the animals to a NOAEL concentration, RNA is extracted from

the Daphnia magna and converted to cDNA that is subsequently used in PCR reactions. Following qPCR

the fold change between a control and the exposed group(s) is determined and statistically significant

changes in gene expression is registered.
---------------------- Page: 13 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
4.4 Choice of genes for study

The below listed genes for reproduction and toxicity should be included in the gene expression analysis

(Table 1 and 2). The method can be complemented with other genes for other types of risk assessment.

Table 1 — Genes with names, function and effect
Gene name Gene symbol Gene function Effect
Toxicology
Metallothionein a mt-a metal binding and transport metal toxicity
Metallothionein b mt-b metal binding and transport metal toxicity
Metallothionein C mt-c metal binding and transport metal toxicity
Catalase cat oxidative stress response free radical/ROS toxicity

Glutathione-s-transferase gst oxidative stress response free radical/ROS toxicity

Zn-superoxide dismutase sod2 oxidative stress response free radical/ROS toxicity
Heat shock protein 70 hsp70 stress response protein misfolding
Heat shock protein 90 hsp90 stress response receptor inactivation
Death-associated protein 1 dap1 apoptosis inhibited cell death
Haemoglobin dhb1 oxygen transport respiratory failure
Ferritin 3 ferritin3 iron-binding protein respiratory failure
Hypoxia-inducible factor 1 hif-1a hypoxia regulator respiratory failure
alpha
δ-Aminolevilunate synthase δ-ALAS heme biosynthesis respiratory failure

Cytochrome P450 4 family cyp 4 organic compound metabolism impaired detoxification of

xenobiotics
Cytochrome P450 314 family cyp 314 metabolism impaired detoxification of
xenobiotics
Reproduction Related Genes
Vitollegenin 1 vtg-1 yolk protein precursor oogenesis
Vitollegenin 2 vtg-2 yolk protein precursor oogenesis
HR3 hr3 ecdysteroids response embryo development
(dimerization with E75)
E74 E74 ecdysteroids response embryo development
E75NR E75NR ecdysteroids response embryo development
(dimerization with HR3)
Fushi tarazu factor-1 ftz-F1 nuclear receptor environmental sex determination

Ecdysone receptor A ecR-A ecdysone receptor (dimerization moulting & metamorphosis

with USP)

Ecdysone receptor B ecR-B ecdysone receptor (dimerization moulting & metamorphosis

with USP)

Ultraspiracle protein usp A/B ecdysone receptor (dimerization moulting & metamorphosis

with EcR-A/B)

Juvenile Hormone Esterase jhe metabolizes Juvenile Hormone development & moulting

Cytochrome P450 314 family cyp 314 20E synthesis development & moulting
Vasa vasa primordial germ cell production germ-line development

Vitelline membrane outer layer vmo-1 separating yolk and albumen egg protection against microbes

protein 1
---------------------- Page: 14 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
Table 2 — Gene primer list
Gene symbol Forward (5’→3’) Reverse (5’→3’)
mt-a GAGCGCCATGCCAAAATCCC TCGTCGTTGTAAAATCCGCCT
mt-b TGGAACCGAATGCAAATGCG CGGACTTGCATGGACAACTG
mt-c AAAGTGTGCCCTCGTTGTCA CTTACAGTCGTCCCCACACG
cat TGGCGGAGAAAGCGGTTCAGC GTGCGTGGTCTCTGGGCGAA
gst TCAGGCTGGTGTTGAGTTTG GAGCAAGCATTTGTCCATCA
sod2 CCTAATGGAGGTGAACCAGAGGGAGAG CCTAGCCAACCCCATCCTGAACCTTGA
hsp70 CGACGGCGGGAGATACGCAC CCACGGAAAAGGTCGGCGCA
hsp90 CCCTCTGTGACACTGGTATTGGCA GCCCATGGGTTCTCCATGGTCAG
dap1 GCTGGTATCGCCAAGAACCTCAAA TGGCGAAGAATTTCTGGATGCGGG
dhb1 GCTGGTATCGCCAAGAACCTCAAA TGGCGAAGAATTTCTGGATGCGGG
ferritin3 GGTGATGGCCTAGGAGTCTTT TGCTCCAAACTTTAGATGCTTT
hif-1a GGTCCAGACCCAAGCCACGC GTCCAGGAGCAGCAGCCAGC
δ-ALAS ACAACTGCGCGAACTGCATCA TGGCCTCTCGGCACTGTCGG
cyp 4 AGCCGAGCACCAACAGCGAA GCGGGCCGGTCAGAATCACC
cyp 314 TCTTGGGTCGGCGTCTGGGA TCGCGGGTGTCAACGCCTTC
vtg-1 CCAGCGAATCCTACACCGTCAAG GAGCCGCACAGACCACAGAG
vtg-2 CGTCCGCCACTGGTTGGGTC GGGGCAGCCAAGACAGAGCG
hr3 AGTCATCACCTGCGAGGGC GAACTTTGCGACCGCCG
E74 TCCAGTGCAGCAGTTCTGTC CGACCACTGCTCAGGGTTAT
E75NR TCCGGAGAAGRATTCAACAAAAGA TGCGAAGAATGGAGCACTGT
ftz-F1 CGCACACCTTCTCCAAATAA TTACCAGTCAACAGTCCCTCAAAA
ecR-A CAGGCACATCAACATCAACAA GGCGACATGGAATCGACA
ecR-B CACCACAACCAACTGCATTTAC CCATTAATGTCAAGATCCCACA
usp A/B TAGGCCACTCGGGTTACTTAAA GAGTGGGTGGTTAGGTGGATAA
jhe GAAGCCACTCGCATGGAA GC CCGGTGAAAGCGCAGGCAGT
cyp 314 TCTTGGGTCGGCGTCTGGGA TCGCGGGTGTCAACGCCTTC
vasa TGGGGGTGGTGGTAGCGGTC CGCGGCTTTCCGTCTTCCGT
vmo-1 TATTACGCGGTTCAGACGTG GTTGTCCGCCTCACTACCAT
5 Test materials
5.1 Daphnia magna reference water

For the exposure of Daphnia magna there is a need for a control reference water. The test water should

be based on the EN ISO 6341 standard water. In all experiments the chemical composition of the water

should be determined. To avoid misinterpretation of the results it is important that the reference water

is adjusted so that macro-elements, salinity, pH, temperature and DOC of the reference water is in

accordance with these variables in the leachate.
---------------------- Page: 15 ----------------------
kSIST-TS FprCEN/TS 17883:2022
FprCEN/TS 17883:2022 (E)
5.2 Daphnia magna culture
5.2.1 Obtaining Daphnia magna from culture

Young daphnids produced asexually can be obtained from the healthy culture. The culture should show

no signs of stress such as the presence of males, ephippia or high mortality rate. It is recommended to not

use the first brood obtained from the culture for any test. For determination of 96 h EC the exposure

should be initiated with test animals less than 24 h old and they should be obtained from the same culture.

It is also recommended to have a pre-test acclimation (about 48 h) period for stock animals if the

exposure conditions (light, temperature, medium) are different from the ones used to maintain stock

animals. For gene expression analysis, the exposure has to start when the animals are 72 h old.

5.2.2 Obtaining Daphnia magna from dormant eggs (ephippia)

Daphnia dormant eggs can be obtained commercially. If the procedure starts from hatching of ephippia

the hatching shall be initiated 3 days prior to test.
Procedure

1. Pour the contents of the one vial with ephippia into the sieve with 100 µm mesh size.

2. Rinse the dormant eggs with tap water in order to get rid of all the traces of storage medium.

3. Transfer the dormant eggs to 50 mm petri dish filled with 10 ml pre aerated reference water.

4. Incubate the covered petri dish for 72 h, at 20 °C to 22 °C with continuous illumination.

The first neonates can appear even before 72 h incubation time depending on the incubation conditions,

but the mass hatching will occur between 72 h and 80 h. In order to reduce age variations for the test, it

is recommended that neonates hatched after 90 h should not be included in the test.

5.3 Reagents
1. 2-Mercaptoethanol
2. Sodium citrate
3. Sodium acetate
4. Saturated phenol
5. Isoamylalcohol
6. Isopropanol
7. Ethanol
6 Apparatus
Spectrophotometer
qPCR machine
---------------------- Page: 16 ----------------------
...